Перед настоящей статьей стоит непростая задача – показать историческую связь тысячелетий эволюции человеческого рода под названием «гаплогруппа N», состоящего из двух сотен миллионов человек, с группой представителей княжеских родов Российской империи, имеющих ту же гаплогруппу, и чья официальная родословная восходит к Рюрику и Гедимину; объяснить, что такое «гаплогруппы», а значит, изложить основы ДНК-генеалогии, и всё это увязать с ДНК-идентификацией Рюриковичей. Ясно, что в сколь-нибудь умеренно полном, как и в кратком объеме, решение такой задачи нереально, поэтому будем рассматривать статью только как постановку такой задачи, как введение в материал, приведение немногих, но необходимых сведений, способных вызвать интерес к предмету исследования, к его методологии, к потенциалу новой науки – ДНК-генеалогии, или молекулярной истории.
 

 
Напомним, что результаты ДНК-тестирования мужчин в рамках ДНК-генеалогии сводятся к двум основным показателям. Это – гаплотип и гаплогруппа. Гаплотип – это набор чисел, который является «личным номером ДНК-паспорта» любого мужчины, без исключения. А гаплогруппа, фигурально говоря, это обложка паспорта. Это – не индивидуальная, а групповая характеристика. Гаплогруппа определяет носителя гаплотипа в определенный род, или историческое племя. У любой гаплогруппы, как у любого рода или племени, был один общий предок, патриарх. Поэтому как номер паспорта при наличии обложки является уникальным «определителем» человека, так и гаплотип в совокупности с гаплогруппой являются не менее уникальным определителем человека, при условии, что номер (гаплотип) является достаточно протяженным. Примеры дадим ниже.
 

Поддержите проекты Академии ДНК-генеалогии: ваше пожертвование – это дальнейшее изучение истории наших предков, выпуск тематических книг, организация научных мероприятий, исследование палео-днк и ещё многое другое. У нас пока нет других помощников, кроме вас. Поэтому если вы считаете нашу работу полезной, нужной и можете её поддержать, то будем благодарны. Сделать пожертвование от 100 до 5000 руб. можно буквально в один клик по этой ссылке.

 

Если у человека такого номера и паспорта нет, то это не мужчина, а женщина. Именно к такому выводу сейчас нередко приходят археологи, которые именно так наиболее надежно определяют пол скелетного остатка в древнем захоронении. Нет Y-хромосомы, нет мужского гаплотипа и мужской гаплогруппы – значит, женщина. У последних – свой ДНК-паспорт, под названием «митохондриальная ДНК», который они передают своим детям, как девочкам, так и мальчикам. А отец передает исключительно Y-хромосому, и только, разумеется, сыновьям.
 
Поэтому у каждого мужчины в Y-хромосоме своя картина мутаций. У близких родственников картина мутаций похожа, потому что они, родственники, сравнительно недавно произошли от одного общего предка, и дополнительные мутации в их Y-хромосомах еще не успели образоваться. Если общий предок жил тысячелетия назад, то картина мутаций у потомков разная. Как эту картину отображают?
 
Отображают картину мутаций в виде так называемых гаплотипов, упомянутых выше как «личный номер паспорта» каждого мужчины, а именно в виде определенных последовательностей чисел, характерных для каждого человека. Чем эта последовательность длиннее, тем уникальнее гаплотип. Например, у автора этих строк гаплотип Y-хромосомы, состоящий из 111 чисел, записывается в следующем виде:
 
13 24 16 11 11 15 12 12 10 13 11 17 – 16 9 10 11 11 24 14 20 34 15 15 16 16 – 11 11 19 23 15 16 17 21 36 41 12 11 – 11 9 17 17 8 11 10 8 10 10 12 22 22 15 10 12 12 13 8 15 23 21 12 13 11 13 11 11 12 13 – 31 15 9 15 12 25 27 19 12 12 12 12 10 9 12 11 10 11 12 30 12 14 25 13 9 10 18 15 20 12 24 15 12 15 24 12 23 19 11 15 17 9 11 11
 
Это — так называемый 111-маркерный гаплотип. Здесь первое число показывает, что в одном из маркеров, или локусов Y-хромосомы определенная последовательность нуклеотидов повторяется 13 раз. В другом маркере, который здесь показан как следующий, блок нуклеотидов повторяется 24 раза, и так далее.
 
В академических публикациях по популяционной генетике, впрочем, пока продолжают использовать гаплотипы от 8- до 17-маркерных, и это тот случай, когда «любители» далеко обогнали «профессионалов». Хотя те любители на самом деле зачастую намного квалифицированнее професcионалов, это просто профессионалы называют тех «любителями», чтобы не признавать свое колоссальное отставание и интеллектуальный застой в популяционной генетике. Этот вопрос никак не обойти при изложении основ ДНК-генеалогии.
 
Естественно, чем длиннее гаплотип, тем выше вероятность того, что в нем произойдет мутация. Как уже не раз здесь пояснялось, мутация в гаплотипах – это результат ошибки в копировании блоков нуклеотидов, тех самых «коротких тандемных повторов», биологической системой копирования ДНК в клетке. Каждый нуклеотид мутирует, то есть копирующая системе ошибается при копировании протяженных гаплотипов, со средней вероятностью примерно 0.00178 раз в поколение при протяженнности поколения 25 лет, или раз в 560 поколений, или раз в 14 тысяч лет. Величина поколения в 25 лет в ДНК-генеалогии называется условным поколением, она – сугубо математическая величина. Если кому-то больше нравится брать 30 лет за поколение, то вероятность мутации на 30 лет составит примерно 0.00214, или раз в 468 поколений (по 30 лет), или раз в 14 тысяч лет. Как видим, конечный результат получается точно такой же.
 
Итак, у любого человека можно выявлять гаплотип с разным разрешением, это будет один и тот же «ДНК-генеалогический паспорт», только разрешение, естественно, тем больше, чем более протяженный гаплотип. Надо сказать, что наука не остановилась на 111-маркерном гаплотипе, и, например, у того же автора определен уже 431-маркерный гаплотип:
 
13 24 16 11 11 15 12 12 10 13 11 30 16 9 10 11 11 24 14 20 34 15 15 16 16 11 11 19 23 15 16 17 21 36 41 12 11 11 9 17 17 8 11 10 8 10 10 12 22 22 15 10 12 12 13 8 15 23 21 12 13 11 13 11 11 12 13 – 31 15 9 15 12 25 27 19 12 12 12 12 10 9 12 11 10 11 12 30 12 14 25 13 9 10 18 15 20 12 24 15 12 15 24 12 23 19 11 15 17 9 11 11 – 10 12 15 15 10 10 8 8 9 13 7 8 10 10 13 14 14 15 31 32 11 10 9 9 8 24 8 8 8 16 22 22 24 21 23 14 16 25 28 15 15 6 11 14 15 8 14 11 12 10 11 10 10 11 11 18 10 12 10 7 10 5 8 9 5 5 11 15 8 29 6 7 10 13 11 6 7 7 7 16 10 11 16 22 23 11 12 12 10 7 12 12 13 7 3 20 18 11 11 8 9 13 13 10 11 22 12 16 13 14 11 11 12 10 12 9 13 9 12 11 12 16 7 14 12 10 9 10 4 7 7 13 13 12 11 9 11 10 11 14 8 4 8 6 11 11 16 9 11 13 19 12 12 9 10 9 9 11 11 9 9 14 14 15 9 7 10 12 14 13 14 14 12 6 32 10 11 16 8 7 17 17 11 11 6 13 12 13 11 10 7 13 12 7 – 12 12 7 14 17 17 11 25 8 8 12 8 8 11 13 11 12 10 8 13 8 13 14 10 11 9 20 17 15 36 9 13 14 39 33 36 9 10 10 12 18 19 13 9 14 44 10 8 14 9 8 20 11 11 11 11 10 9 9 9 8 8 8 8 9 11 9 23 11 9 16 31 8 20 8 13 12 8 16 10 9 33 27 23 22 10 8 12 10 8 14 8 8 32 55 7 7 5 9 6 11 11 11 13 9 39 33 7 8 27 7 5 13 7 15 28 25 60 42 12 31 22 20 12 3 4
 
Таких гаплотипов в мире определено пока всего несколько десятков, так что практическая польза от них пока невелика, за исключением нескольких специальных случаев, которые будут пояснены ниже.
 
Поскольку «коротких тандемных повторов» в Y-хросомоме многие тысячи (выше показано 431 таких повторов, и это только среди 10 миллионов нуклеотидов Y-хромосомы, этот размер определяется методологией исследования; всего же в Y-хромосоме примерно 58 миллионов нуклеотидов, или, точнее, нуклеотидных пар, но не будем здесь вдаваться в излишние подробности). Отсюда можно заключить, что таких «тандемных повторов» в Y-хромосоме может быть примерно 2500, и это, видимо, максимально возможный размер гаплотипа.
 
Покажем для сравнения 67-маркерный гаплотип представителя Российского Дворянского собрания Г.Н. Гришина:
 
14 23 14 11 11 13 11 13 12 13 14 17 – 17 9 9 11 12 26 14 19 29 15 15 15 15 – 11 10 18 20 14 15 18 19 36 36 14 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 14 10 12 12 18 7 13 20 21 15 12 11 10 11 11 12 11
 
И еще один, представителя Российского Дворянского собрания С.В. Думина:
 
14 23 15 11 11 13 11 12 11 13 15 16 – 17 9 9 11 12 25 14 19 27 14 14 15 15 – 11 11 18 20 14 15 16 19 37 37 13 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 14 10 12 13 18 7 12 22 21 16 12 11 10 11 11 12 11
 
Оба последних значительно отличаются от моего гаплотипа, и на первых 67 маркерах имеют соответственно 72 и 71 мутации по сравнению с моим, но между собой эти два гаплотипа различаются всего на 19 мутаций. Почему такая разница?
 


Г.Н. Гришин и С.В. Думин

Чтобы ответить на этот вопрос, перейдем к понятию гаплогруппы. У меня «обложка паспорта» другая, я принадлежу к другому роду – роду R, и далее к его подгруппе, или субкладу R1a. Г.Н. Гришин и С.В. Думин относятся к роду N, субкладу N1c1. Род R образовался не менее 30 тысяч лет назад, род N – примерно 20 тысяч лет назад, но они образовались независимо друг от друга, и происходят от общего предка в гаплогруппе К (см. ниже), поэтому между нашими родами не менее 50 тысяч лет. За это время и накопились более 70 мутаций между нашими гаплотипами. А два последних гаплотипа образовались в пределах не только рода (гаплогруппы) N, и не только в пределах одного субклада (племени) N1c1, но даже в пределах нижестоящего субклада N1c1a1a-L1026 (ниже объяснено, что это такое, и показана ДНК-генеалогическая диаграмма), которому не более 4000 лет. Это означает, что у отца из рода N1c1a1 родился сын, в Y-хромосоме которого образовалась новая мутация, которую генетики намного позже назвали L1026, и все потомки этого мальчика, которых сейчас миллионы, в своих Y-хромосомах несут эту мутацию. Иначе говоря, тот мальчик стал патриархом субклада N1c1a1a-L1026, и среди его многочисленных потомков – Г.Н. Гришин и С.В. Думин. Их гаплотипы отстоят друг от друга на 19/0.12 = 158 → 187 условных поколений (по 25 лет в поколении), или примерно на 4675 лет, значит, их общий предок жил половину этой дистанции, или примерно 2350 лет назад, во второй половине I тыс. до н.э. Здесь 19 – число мутаций между их 67-маркерными гаплотипами, стрелка показывает поправку на возвратные мутации (поскольку мутации происходят в обоих направлениях, то есть часть мутаций возвращается в исходное положение), 0.12 – константа скорости мутации в 67-маркерных гаплотипах.
 
2350 лет назад, когда жил общий предок Г.Н. Гришина и С.В. Думина, соответствует времени, когда носители гаплогруппы N уже прибыли в Прибалтику двумя миграционными потоками; один, более древний, расселился, начиная с 2500 лет назад на Южной Балтике, другой, более недавний, расселился на 500 лет позже на территории нынешней Финляндии. Их потомки имеют довольно четкое различие в гаплотипах: первые (в итоге они стали в основном южно-балтийскими славянами) имеют характерную «двойную подпись» 9 9 и 14 14 15 15 (и ее вариант 15 15 15 15, который происходит в одну мутацию, называемую мультикопийной, при которой пара одинаковых аллелей, как в данном случае 15 15, переписывается в один ход «поверх» 14 14)
 
14 23 14 11 11 13 11 13 12 13 14 17 – 17 9 9 11 12 26 14 19 29 15 15 15 15 – 11 10 18 20 14 15 18 19 36 36 14 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 14 10 12 12 18 7 13 20 21 15 12 11 10 11 11 12 11 (гаплотип Г.Н. Гришина)
 
14 23 15 11 11 13 11 12 11 13 15 16 – 17 9 9 11 12 25 14 19 27 14 14 15 15 – 11 11 18 20 14 15 16 19 37 37 13 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 14 10 12 13 18 7 12 22 21 16 12 11 10 11 11 12 11 (гаплотип С.В. Думина);
 
вторые, ставшие финнами, имеют характерную «подпись» в тех же участках Y-хромосомы 10 10 и 13 13 14 14. Эта стабильная разница и указывает на разных общих предков обоих миграционных потоков – северного и южного.
 
Откуда получают те числа, которые показаны в гаплотипах? Всё это на самом деле четко определено и зафиксировано. В первом маркере (под названием DYS393) повторяется четверка нуклеотидов AGAT, то есть аденин-гуанин-аденин-тимин
 
GTGGTCTTCTACTTGTGTCAATAC/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/
AGAT/AGAT/AGAT/AGAT
/ATGTATGTCTTTTCTATGAGACATACCTCATTTTTTGGACTTGAGTTC,
 
и повторы обрамляются уже неупорядоченными последовательностями нуклеотидов в ДНК, как показано выше. Этот участок в ДНК и есть локус, он же маркер DYS393. Во втором маркере, под названием DYS390, повторяется уже другая четверка – TCTG, то есть тимин-цитозин-тимин-гуанин, которая переходит в четверку TCTA, то есть тимин-цитозин-тимин-аденин, и число повторов складывается:
 
TATATTTTACACATTTTTGGGCCCTGCATTTTGGTACCCCATAATATATTCTATCTA/TCTG/TCTG/TCTG
/TCTG/TCTG/TCTG/TCTG/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA
/TCTG/TCTA/TCTA/TCTA
/TCATCTATCTATCTTTCCTTGTTTCTGAGTATACACATTGCAATGTTTT
CATTTTACTGTCAC.
 
Перечисленные четыре нуклеотида — это язык ДНК, который состоит из четырех букв при сокращенной записи. Эти нуклеотиды комбинируются парами, их так и называют — «пары оснований». Они фактически держат двойную спираль ДНК. Нам эти четверки (а также тройки нуклеотидов, и другие типы повторов) в маркерах ДНК в дальнейшем не понадобятся, это описание мы даем только для того, чтобы показать, что за числами в гаплотипах стоят масштабные исследования, которыми занимаются в мире сотни и тысячи человек.
 
Мы видим, у меня, в гаплогруппе R1a, первый маркер дал 13 повторов, а у моих коллег из гаплогруппы N1c1 там 14 повторов. И вообще, из первых 12 маркеров (их называют «первой панелью маркеров») в семи маркерах число повторов у нас разное, и еще в двух маркерах есть вариации. Это потому, что рода разные, и за 50 тысяч лет они по мутациям разошлись довольно далеко. Взглянем, у каких маркеров числа (под названием «аллели») сохранились. Это по порядку 4-й, 5-й и 10-й, они имеют классификационные наименования DYS391, DYS385a и DYS389a (DYS означает «DNA Y Segment», а номер – системный номер соответствующего участка в Y-хромосоме согласно классификации). Константы скорости мутации в этих участках равны соответственно 0.00265, 0.0013 и 0.008 мутаций в расчете на условное поколение в 25 лет. Иначе говоря, мутации в этих участках (или локусах) происходят раз в 9400, 19200 и 31250 лет, соответственно. За 50 тысяч лет могли бы и мутировать, и не один раз, но в ДНК наблюдаются возвратные мутации, которые происходят с такими же константами скоростей (поскольку ДНК при копировании «не знает», в какую сторону прошла мутация до того), и при возврате мутации аллель приобретает «исходный вид». Поэтому при расчетах необходимо вводить поправки на возвратные мутации.
 
Но единичные мутации не дают хорошей статистики, поэтому желательно рассматривать большие выборки гаплотипов, в сотни, а то и в тысячи гаплотипов. В среднем же 67-маркерный гаплотип мутирует с константой скорости мутации 0.12 за 25 лет, то есть одна мутация в среднем происходит в гаплотипе за 1/0.12 поколений, то есть примерно раз в 8 условных поколений, или раз в 208 лет. С такими протяженными гаплотипами уже удобно работать, они дают неплохое разрешение при расчетах. Именно так было получено, что 19 мутаций между парой гаплотипов выше соответствуют временной дистанции 4675 лет, а общий предок жил половину этой временной дистанции назад. При расчетах была сделана поправка на возвратные мутации, которые происходят на больших отрезках времени, превышающих 25 условных поколений, то есть 625 лет.
 
Теперь понятно, почему гаплотипы выбирают так, чтобы в них таких маркеров было как можно больше (но все-таки чтобы оставаться в рамках практичности), и в ранних работах использовались 6-маркерные гаплотипы, затем 12-маркерные, 17- и 19-маркерные, затем 25- и 37-маркерные, а сейчас работа рутинно ведется с 67- и 111-маркерными гаплотипами (правда, в академических публикациях это обычно от 8 до 17 маркерных гаплотипов). В 111-маркерных гаплотипах одна мутация происходит в среднем за 5 поколений, поэтому у 111-маркерных гаплотипов разрешение лучше других. Но их определять дороже, чем более короткие, поэтому в академических исследованиях, при постоянной нехватке денежных средств, приходится работать с более короткими гаплотипами. Длинные гаплотипы определяют в коммерческих компаниях, обычно персонально, по индивидуальному заказу, и обычно передают в общественные базы данных. Сейчас в общественных базах данных — сотни тысяч гаплотипов, и базы прирастают многими гаплотипами ежедневно.
 
Как мы покажем ниже, эти гаплотипы, а именно числа в них, напрямую связаны с хронологией древних миграций людей, переходами людей на новые места, событиями прошлого — войнами, климатическими катаклизмами, эпидемиями, в общем, со всем тем, что так или иначе влияло на численность популяций человека в определенные времена и на определенных территориях. Например, расчеты могут показать, когда носители гаплогруппы N были на Урале, когда они появились в Прибалтике, когда древние арии появились на Русской равнине, когда они появились в Индии, Иране, на Ближнем Востоке — потому что эти события приводили к появлению на этих территориях и в те времена общих предков популяций, которые разрастались вплоть до нашего времени, образуя «кусты» гаплотипов со всеми мутациями в них, то есть изменениями чисел в маркерах.
 
Обратимся к гаплогруппам, тем самым «обложкам паспорта», групповым характеристикам. Как было сказано, большое число мутаций и, соответственно, большое временное расстояние между гаплотипами гаплогруппы R1a и N1c1 (десятки тысячелетий) вызвано тем, что они относятся к разным родам человека, а относительно умеренное расстояние между двумя гаплотипами одной гаплогруппы (и к тому же одного субклада, N1c1), всего несколько тысяч лет, было вызвано тем, что они фактически родственники, в рамках понятий ДНК-генеалогии. В целом понятия гаплогруппы и субклада часто взаимозаменимы, и определяются контекстом изложения. И гаплогруппы, и субклады определяются необратимыми мутациями в Y-хромосоме, в отличие от обратимых мутаций в гаплотипах (тех самых повторов, что описаны выше, которые в научной литературе называют STR, от Short Tandem Repeats). Эти необратимые мутации, которые называют снип-мутациями (от сокращения SNP, Single Nucleotide Polymorphism), стараются подобрать такие (для идентификации гаплогрупп и субкладов), которые были бы стабильными за все время существования человечества. Поэтому гаплогруппы и субклады стабильны, не меняются во времени.
 
Всего в мире насчитывают 20 основных гаплогрупп, которые обозначают буквами латинского алфавита, от А до Т, хотя систему порой нарушают. В последнее время в классификацию добавили гаплогруппы A0 и A00, хотя их носителей обнаружили считанные единицы, все они живут в Африке. Но они настолько отстоят по снип-мутациям от всех остальных людей на Земле (тестированных на мутации в ДНК), что их пришлось выделить в отдельный род-гаплогруппу. Помимо этого, были идентифицированы промежуточные, сводные гаплогруппы, такие как СТ, DE, GHIJK и другие (см. диаграмму ниже), так что минимальный состав генеалогического дерева мужской половины человечества включает уже 39 основных гаплогрупп, то есть главных уровней Y-хромосомного генеалогической структуры. С подгруппами это составляет уже много сотен.
 
Если же считать все уровни генеалогического дерева (уровень в этом случае – это субклад), то гаплогруппа R1a, основная гаплогруппа (род) этнических русских, насчитывает 66 субкладов, гаплогруппа R1b (основной западно-европейский род) – 289 субкладов, гаплогруппа N – 34 субклада. Разница в числах объясняется не тем, что последняя гаплогруппа более молодая, а тем, что она менее изучена. Она редко встречается в Западной Европе, где наиболее часта гаплогруппа R1b, и потому ей меньше занимаются. Но в последнее время к поиску новых субкладов стали применять геномные методы, при которых анализ генома идет по миллионам снип-мутаций, и число субкладов гаплогруппы N резко увеличилось. Ниже мы покажем текущую диаграмму снип-мутаций гаплогруппы N. Сама же гаплогруппа N образовалась при появлении необратимой мутации в виде спонтанного превращения одного нуклеотида в другой в ДНК (Y-хромосоме) патриарха, или его выжившего потомка, в свою очередь потомки которого дожили до настоящего времени в количестве около двухсот миллионов человек (только в Китае их по оценкам более 140 миллионов, или две трети от всех носителей гаплогруппы N в мире; на втором месте – Россия с 10 миллионами носителей гаплогруппы N, примерно 14% от всего мужского населения страны; на третьем месте – Украина с Белоруссией). У него, патриарха гаплогруппы N, по сравнению с ДНК его отца (относящегося к сводной гаплогруппе NO) при зачатии и первом копировании Y-хромосомы произошло спонтанное превращение нуклеотида гуанина в аденин, и это произошло в участке Y-хромосомы под номером 15 миллионов 469 тысяч 724. С тех пор все носители гаплогруппы N и ее субкладов, то есть прямые потомки того мальчика, ставшего патриархом огромного рода, несут в своих ДНК этот снип, под индексом М231. Всего же в Y-хромосоме мужчин насчитывается, как сообщалось выше, примерно 58 миллионов нуклеотидов.
 
Приведем общее дерево гаплогрупп современного человечества. На нем можно найти гаплогруппу N, и гаплогруппу R с субкладом R1a, и убедиться, что они на самом деле отстоят друг от друга довольно далеко.
 

Перейдем к гаплогруппе N в несколько бóльших деталях.
 

 
Дерево гаплогруппы N показывает динамику ее субкладов за последние 20 тысяч лет. Первыми от дерева отошла южноазиатская ветвь субклада N1a, затем китайские и вьетнамские ветви субклада N1b, и миграцию на север, через алтайский регион, продолжили субклады N1c. Было это примерно 8 тысяч лет назад. Примерно 6 тысяч лет назад образовалась евразийская ветвь N1c1a1-L708, за ней центральная евразийская ветвь L1026, примерно 5 тысяч лет назад. Около 3 тысяч лет назад образовалась южно-балтийская ветвь, к которой принадлежит группа князей Российской империи, датировка общего предка которых согласуется со временем жизни легендарного Рюрика. Об этом речь в деталях пойдет позже, но сейчас важно отметить, что это – южно-балтийская, славянская ветвь, и характерная «подпись» в их гаплотипах опять типичная южно-славянская, как и у Г.Н. Гришина и С.В. Думина, гаплотипы которых приведены выше. В них есть вариации типа 14-15-15-15 (Гагарин), 14-14-14-14 (Пузына), так и 15-15-15-15 (Гришин), но это все продукты одной мутации в мультикопийных маркерах, а одна мутация может пройти в любом поколении у любого человека.
 

В заключение данного раздела приведем еще одну диаграмму субкладов гаплогруппы N, более детальную, дополненную геномными определениями снипов (BigY и YFull):
 

 
Рис. 1. Дерево субкладов гаплогруппы N. Расшифровка цветовой кодировки приведена в правой нижней части диаграммы. ISOGG – International Society of Genetic Genealogy, Big-Y – геномный проект, рассматривающий фрагменты Y-хромосомы общим размером 10 миллионов пар оснований, YFull – геномный проект, рассматривающий фрагменты Y-хромосомы общим размером 30 миллионов пар оснований (вся Y-хромосома – 58 миллионов пар оснований), HGDP – Human Genome Diversity Project. Источник – сетевые данные Jakko Väyrynen и G. Dunkel.
 
Диаграмма субкладов гаплогруппы N выше и рис. 1 показывают, что узловым субкладом, от которого произошло расхождение уральского миграционного потока гаплогруппы N1c1 на южно-балтийское и финское направления, был N1c1-VL29 (европейская ветвь). К юго-восточной части Балтийского моря ушел субклад L550 (южно-балтийская ветвь), к северо-западной, финской части – субклад CTS9976 и далее L1022. Кстати, надо отметить, что у Г.Н. Гришина, о гаплотипе которого речь шла выше, снипа L1022 в его Y-хромосоме нет. То есть Г. Гришин не относится к финской или скандинавской группе. Собственно, скандинавской группы в отношении гаплогруппы N нет, поскольку миграции, которые продолжались уже в нашей эре с востока на запад, несли с собой или «финские» гаплотипы (с «подписью» 10-10 13-13-14-14, или «славянские», 9-9 14-14-15-15 и их ближайшие производные). В Швеции, например, есть и те, и другие, о чем будет рассказано ниже.
 
Итак, как мы видим, мутации в гаплотипах потомков расходятся от предкового гаплотипа как круги по воде, число мутаций легко рассчитывается, и они подчиняются довольно простым количественным закономерностям. Для кругов на воде, расходящихся от места, куда был брошен камень, легко рассчитать, когда был брошен камень, если знать скорость распространения волны и место нахождения круговой волны в данный момент времени. Чем больше прошло времени – тем дальше круги ушли, тем больше они разошлись. Так и в гаплотипах – чем больше время, прошедшее от общего предка, тем больше мутаций накопилось в гаплотипах его потомков. Число этих мутаций связано со временем, прошедшим от общего предка, с числом гаплотипов в серии, и с константой скорости мутации в гаплотипах, и выражается простой формулой: n/N = kt, где n – число мутаций в серии из N гаплотипов, k – константа скорости мутации (в числе мутаций на гаплотип за условное поколение, равное 25 лет), t – число условных поколений, с табличной поправкой на возвратные мутации. На сотнях и тысячах примеров показано, что эта формула работает при любом числе гаплотипов и мутаций в них, и при любом времени, прошедшем от общего предка рассматриваемых гаплотипов. Однако при очень больших временах, более 10-20 тысяч лет, и особенно более 100 тысяч лет, нужно использовать гаплотипы с «медленными» маркерами, то есть с малыми константами скоростей мутаций, и тем самым снижать число мутаций и число возвратных мутаций. По аналогии, вряд ли целесообразно изучать скорости радиоактивного распада элементов со временами полураспада в тысячелетия, используя секундомер. Или пытаться изучать круги на воде за километры от места, куда был брошен камень, для этого нужно значительно более мощное воздействие. Как всегда, нужен конкретный анализ в конкретной ситуации, единых подходов на все случаи жизни не бывает. Варианты конкретного анализа в конкретных ситуациях и рассматривает ДНК-генеалогия.
 
Мутации в ДНК-генеалогии – это не только единичные необратимые мутации-снипы, описанные выше, которые определяют гаплогруппы и субклады, но и обратимые мутации, меняющие числа повторов, или аллели, в гаплотипах. В русскоязычной литературе их называют просто «мутации», с пониманием, что это не те мутации (в генах), которые обычно возникают под действием радиации. Переход числа повторов в маркере Y-хромосомы от 25 к 24 или 26 (или наоборот) имеет совершенно другую природу, чем «поломка» гена. Такой переход является следствием спонтанной, случайной ошибки ДНК-копирующей «биологической машины», это процесс первого порядка с точки зрения физико-химической или биологической кинетики, он не зависит от внешних воздействий.
 
Что важно отметить – в большинстве случаев результаты расчетов почти не зависят от размера выборки (при числе гаплотипов больше двух-трех десятков), то есть они достаточно устойчивы к статистическим вариациям. Размер выборки увеличивает точность, и то только до определенных пределов. Это относится к довольно большим популяциям, которые перемешались за тысячелетия, но именно с такими обычно и работают.
 
Приведем пример. В таблице ниже даны расчеты времени до общего предка гаплогруппы R1a на постсоветском пространстве. Это, в основном, — Россия, Украина, Белоруссия, Литва, Латвия, Эстония и Казахстан. Видно, что при увеличении выборки от 26 гаплотипов до двух тысяч результаты практически одинаковы в пределах погрешности расчетов. Поэтому когда скептики (а такие есть всегда и везде) повторяют, что несколько десятков или сотен гаплотипов – это ничто для расчетов, им стоит напоминать, что дело не в количестве гаплотипов, а в их перемешанности на рассматриваемой территории. На равнине перемешивание обычно вполне достаточное, в горах – меньше, но и там, как мы видели на примерах карачаево-балкарских и осетинских гаплотипов, данные вполне воспроизводятся по разным выборкам.
 

 
Теперь, когда рамки ДНК-генеалогии обозначены, и ряд иллюстраций из истории гаплогруппы N приведены, перейдем к Рюриковичам, в качестве которых часто рассматривают князей Российской империи. Посмотрим, какие к этому есть основания. А также более внимательно расмотрим вопрос о возможном происхождении князей – как предполагаемых Рюриковичей – от скандинавов.
 
Сразу скажем, что последнее не только маловероятно, но может быть практически исключено. На это указывают данные по гаплогруппе R1a, согласно которым скандинавы имеют характерные мутации в гаплотипах, что и определяет их в субклад R1a-Z284, возраст которого около 5 тысяч лет. На территории России, Украины, Белоруссии этого субклада практически нет. Карта показывает, что в России выявлен всего один носитель скандинавского субклада. В последнее время их найдено еще трое, из нескольких тысяч человек. Другими словами, в России скандинавов практически не было, во всяком случае, на статистически детектируемом уровне, хотя норманисты декларирует, что их на Руси были десятки тысяч или (Л. Клейн) до полумиллиона скандинавов (см. ссылки в работе профессора В.В. Фомина «Клейн как диагноз-2, или дело пустомели Петрея еще живет. Пока», которые якобы и были Русь и управляли ею, от ремесленников и руководителей до высшего состава власти. Ясно, что этого не могло быть, потому что немыслимо, чтобы они не оставили большого (или хотя бы умеренного) количества потомков. Напротив, карта показывает, что пути скандинавов были практически исключительно на запад, на Британские острова. Действительно, там имеется достаточно большое количество носителей скандинавского субклада R1a-Z284, потомков тех скандинавов. Похоже, что те, кого историки (в особенности ангажированные) принимают за «скандинавов» на Руси были на самом деле русскими, славянами, которые вполне могли иметь скандинавские мечи, возводить постройки «скандинавского» типа и привозить из боевых походов скандинавские трофеи.
 
О «шведском происхождении Рюрика» подробно рассказывалось в статье на Переформате два года назад. Там указывалось, что вокруг восточной Прибалтики живут два народа, финны и южные балты, каждый со своим набором гаплотипов и гаплогрупп/субкладов. Надо, впрочем, сказать, что народа «балты» нет, это просто фигура речи, региональное, географическое понятие. Например, до недавнего времени белорусы и литовцы были практически неразделимы, это были славяне. Как, впрочем, и поляки, о славянском отнесении которых никто не спорит. Цитата:
 

 
Если уходить глубже в гаплогруппу N1c1, то у финнов появляется N1c1-CTS9976-L1022, а у южных балтов появляется N1c1-L550. Это означает, что более северный миграционный поток донес свою гаплогруппу N1c1-CTS9976 до территории современной Финляндии, а в более южном потоке и несколько более древнем, южно-балтийском, у кого-то из отцов-основателей проскочила мутация L550, в потомках закрепилась, и именно эти потомки в основном выжили среди южных балтов гаплогруппы N1c1. Вот такая лотерея, в которую природа играет, не переставая. Естественно, к южным балтам могли примкнуть и те, кто сохранил исходную гаплогруппу N1c1, без L550, и тем не менее стал частью южных балтов. А какое-то количество тех, кто получил L550, могли уйти с финнами, или переселиться к ним позже, например, во времена Российской империи, в которую Финляндия входила на протяжении более ста лет (1809-1917), а до того финнами семь веков правили шведы. Переселяются из России в Финляндию и сейчас. Поэтому надо понимать, что ДНК-генеалогические признаки не являются абсолютными (как, впрочем, и любые другие), но они, будучи вероятностными, помогают приходить к определенным выводам, особенно, когда подкрепляются положениями археологии, антропологии, лингвистики, которые, естественно, тоже не являются абсолютными. Так происходит постепенное приближение «к истине», которая тоже не абсолютна, потому что в постоянном приближении. Так работает наука.
 
Князья Российской империи, носители гаплогруппы N, имеют в основном субклад N1c1-L550. Дерево их гаплотипов и соответствующий анализ также были рассмотрены в статье на Переформате два года назад. Было показано, что князей – одиннадцать человек – Гагарин, Кропоткин, Хилков, Пузына, Путятин, Вадбольский, Шаховской, Ржевский, Массальский, Лобанов-Ростовский и Корибут-Воронецкий. Это те, кто прошли тест на 67-маркерные гаплотипы, наиболее чувствительные к вариациям. Базовый, то есть предковый гаплотип для указанных одиннадцати «Рюриковичей» в данном случае определяется надежно. Он – следующий:
 
14 23 14 11 11 13 11 12 10 14 14 16 – 18 9 9 11 12 25 14 19 28 14 14 15 15 – 11 11 18 20 14 15 16 19 34 34 15 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 18 7 13 21 21 16 12 11 10 11 11 12 11
 
Все 11 человек отличаются по своим гаплотипам от приведенного базового на 58 мутаций, что дает 58/11/0.12 = 44 → 46 условных поколений (по 25 лет каждое) назад, или 1150±190 лет от их общего предка. Это – примерно 862±190 год, что не противоречит годам жизни Рюрика (умер в 879 году) или его именитого современника. На самом деле, совпадение здесь практически абсолютное, но не будем на этом фокусироваться, расчетная погрешность не позволяет.
 
Теперь в качестве упражнения рассчитаем, как гаплотипы представителей Дворянского собрания Г.Н. Гришина и С.В. Думина соотносятся с приведенным предковым гаплотипом «Рюриковичей». Мы вынуждены брать этот термин в кавычки, потому что, строго говоря, прямых, документальных подтверждений этому нет, хотя они, как правило, имеют четкую официальную родословную. Более того, как уже упоминалось, есть «Рюриковичи» и в гаплогруппе R1a, с таким же временем жизни общего предка, как и в гаплогруппе N1c1. Снять кавычки было бы научно некорректным, поскольку имеем две пока несовместимых ситуации.
 
Итак, рассмотрим три 67-маркерных гаплотипа – базовый гаплотип «Рюриковичей», и гаплотипы упомянутых представителей Российского Дворянского собрания:
 
14 23 14 11 11 13 11 12 10 14 14 16 – 18 9 9 11 12 25 14 19 28 14 14 15 15 – 11 11 18 20 14 15 16 19 34 34 15 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 18 7 13 21 21 16 12 11 10 11 11 12 11 («Рюрик»)
 
14 23 14 11 11 13 11 13 12 13 14 17 – 17 9 9 11 12 26 14 19 29 15 15 15 15 – 11 10 18 20 14 15 18 19 36 36 14 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 14 10 12 12 18 7 13 20 21 15 12 11 10 11 11 12 11 (Г.Н. Гришин)
 
14 23 15 11 11 13 11 12 11 13 15 16 – 17 9 9 11 12 25 14 19 27 14 14 15 15 – 11 11 18 20 14 15 16 19 37 37 13 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 14 10 12 13 18 7 12 22 21 16 12 11 10 11 11 12 11 (С.В. Думин)
 
Между ними попарно 18 и 14 мутаций (Г.Н. Гришин и С.В. Думин от «Рюрика», соответственно), что дает 18/0.12 = 150 → 176 условных поколений, или 4400 лет, и 14/0.12 = 117 → 133 условных поколения, или 3325 лет, соответственно, как сумму временных расстояний от общего предка наших коллег до «Рюрика» и до современных гаплотипов Г.Н Гришина и С.В. Думина. Сам «Рюрик» жил примерно 1150 лет назад, как мы определили выше. Поэтому общий предок «Рюрика» и С.В. Думина жил примерно (3325+1150)/2 = 2240 лет назад, а «Рюрика» и Г.Н. Гришина (4400+1150)/2 = 2775 лет назад.
 
Если подобные расчеты провести между гаплотипами наших коллег и базовым гаплотипом Гедиминовичей
 
14 23 15 11 11 13 11 12 10/11 14 15 16 – 17 9 9 11 12 25 14 19 28 14 14 15 15 – 10 11 18 20 13 14 15 18/19 36 36 14 10 – 11 8 15 17 8 8 10 8 11 10 12 21 22 13 10 12 12 16 7 13 20 21 16 12 11 10 11 11 12 11 («Гедимин»)
 
то разница в мутациях составит уже 21 и 16, соответственно. Таким образом, оба наших коллеги заметно более близки к Рюриковичам, чем к Гедиминовичам. Общий предок Гедиминовичей и С.В. Думина жил примерно 2200 лет назад, общий предок Гедиминовичей и Г.Н. Гришина – примерно 2900 лет назад.
 
Возвращаясь к «Рюриковичам», мы видим, что гаплогруппа N1c1 вписывается по общим предкам «Рюриковичей» в группу князей Российской империи. Но кто такие N1c1? Это что, в самом деле шведы, или финны, или датчане? Да ничего подобного. Давайте разберемся.
 
Как уже упоминалось, гаплогруппа N1c1 разошлась в итоге своей миграции на Балтику на две линии, одна финская и одна южно-балтийская, которая есть славянская, русская (на территории России), или польская, или литовская, или латышская. Напомним, что у них есть два характерных различия. У южных балтов, по сути славян, в гаплотипе есть пара 9-9 и четверка 14-14-15-15. ДНК-генеалог скажет, что это в локусах DYS459a,b и DYS464a,b,c,d, соответственно. Вот они, выделены в предковом гаплотипе русских князей гаплогруппы N1c1:
 
14 23 14 11 11 13 11 12 10 14 14 30 – 18 9 9 11 12 25 14 19 29 14 14 15 15 – 11 11 18 20 14 15 16 19 34 34 14 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 18 7 13 21 21 16 12 11 10 11 11 12 11
 
У финнов там, в основном, 10-10 и 13-13-14-14. Это – очень заметные различия. Давайте отбросим все остальные повторы (так называемые аллели), и построим дерево гаплотипов только для этих двоек и четверок, в совокупности. Для построения дерева 6-маркерных гаплотипов привлечем несколько сотен гаплотипов N1c1 из доступных баз данных. Вот что получилось:
 

Рис. 2. Дерево гаплотипов 425 человек гаплогруппы N1c1, выявленные по базам данных. Гаплотипы составлены из двоек DYS459 и четверок DYS464. Справа по кругу – в основном славяне (базовый гаплотип 9-9 14-14-15-15), слева на удаленной ветви – в основном финны (базовый гаплотип 10-10 13-13-14-14). Гаплотипы справа по кругу (в основном славяне) принадлежат к субкладу N1c1-L550, гаплотипы слева на удаленной ветви (в основном финны) к этому субкладу не относятся. Большинство из 11 русских князей гаплогруппы N1c1 принадлежат правой ветви, в основном славянской. Важность этого положения объясняется выше, на схеме субкладов гаплогруппы N.
 
Итак, слева – финны. Базовая шестерка 10-10, 13-13-14-14. Имена – Korhonen, Pennainen, Mottonen, Hirvonen, Raisanen, Pohjalainen, Nyyssonen, Hakkarainen, Haikonen, Heikkinen, Lehmoinen, Randalainen, Suikkanen, Vihavainen, Kosunen, Vetelainen, Kemilainen, Toivanen, Wayrynen, Komonen, Keskinen, Leppanen, Mikkonen, Kinnunen, Pyykonen, Rahkonen, Parkulain, Kouko, Heikinpoika, Matinpoika, Marponpoika, Fransinpoika и подобные.
 
Справа – в основном славяне, базовая шестерка 9-9, 14-14-15-15. Имена – Селиванов, Козлов, Свистунов, Данилович, Архипов, Муковников, Потураев, Ларионов, Шеховцов, Кулешов, Забелин, Назаров, Никитин, Васильев, Матюшонок, Прокопович и так далее. Здесь в основном русские, украинцы, белорусы, поляки. Здесь же латыши – Аузинс, Ласианис, Витавскис; литовцы – Багдонавичус, Семенас, Довыденас, Андреас, Станкевичус, Сабис, Бартайтис, Грусаускас и подобные имена; поляки – Хилинский, Крузиковский, Новак, Орловский, Крупиенский, Буйновский, Клобуковский, Мосжинский, Пиотровский, Рыкацевский, Жуковский, и так далее. Напомню, что у них всех шестерка аллелей 9-9, 14-14-15-15. Славяне, во всяком случае, по происхождению.
 
Смотрим ещё раз на шестерку аллелей в гаплотипах князей-рюриковичей. Та же шестерка (редко – с одной мутацией, от чего никто не застрахован):
 

Ну, и где там финны? Нет их там. Это – южные балты, славяне. У Гагарина и Пузыны – одноразовые мутации от предкового гаплотипа. У Пузыны одношаговая мутация 14-14-15-15 → 14-14-14-14, так называемая палиндромная, или мультикопийная. Совершенно обычное дело.
 
Посмотрим на норвежские, шведские, эстонские гаплотипы. Среди 425 гаплотипов N1c1 их соответственно 10, 21, 3 гаплотипа, и еще 2 датских. Негусто. Обычно столь малое количество гаплотипов характерно для «туристов», которые еще не успели дать достаточно обильное потомство. И это понятно – носители гаплогруппы N1c1 продвигались с востока на запад, как со стороны финской, так и южно-балтийской. Это в Скандинавии не свои гаплотипы, все – мигранты с востока. Вот и имеем – в Дании оба гаплотипа имеют 9-9, 14-14-15-15, то есть южно-балтийские. Оба – идентичные, то есть их общий предок жил в пределах последних двух столетий. Какие уж там Рюриковичи… Три эстонских гаплотипа – опять южно-балтийские, вовсе не финские. У всех трех четверка 14-14-15-15, нехарактерная для финских гаплотипов, но характерная для славянских. Общий предок жил в начале нашей эры, что обычно для N1c1.
 
Из 10 норвежских гаплотипов четыре – славянские, 9-9, 14-14-15-15, и еще два – продукты одношаговой мутации от них. То есть 60% славянских, южно-балтийских гаплотипов N1c1. Всего один гаплотип – финский, еще два – продукты палиндромных мутаций, которых у Рюриковичей нет. Наконец, у шведов – треть славянских гаплотипов 9-9, 14-14-15-15; еще девять (в сумме – 16, три четверти от всех) – его мутированные производные; и пять гаплотипов (четверть от всех) – финские, 10-10, 13-13-14-14, которых у Рюриковичей нет. Вот такая цена высказываниям историка В. Волкова, что «у рюриковичей – шведские гаплотипы». Нет «шведских гаплотипов» вообще в природе, это – визитеры со стороны славян и со стороны финнов, но гаплотипов последних у Рюриковичей нет. Вот так и получаем ответ: Рюриковичи – либо носители гаплогруппы R1a, славяне, либо носители южно-балтийской, славянской ветви гаплогруппы N1c1.
 
Надо сказать, что когда я упомянул в какой-то дискуссии про арийскую топонимику Русского севера, появился некий «критик», с претензиями на лингвиста, и заявил, что никакой арийской топонимики там нет, это давно уже опровергнуто. На мой вопрос представить ссылки в научной литературе он пообещал это сделать, но пропал бесследно. Цену словам этого «критика» показал другой пример, когда он уверенно объявил, что в шумерском языке есть около двухсот индоевропейских слов. Правда, когда кто-то более знающий объяснил, что эти «индоевропейские слова» являются недоразумениями и подгонками, и в лингвистике давно опровергнуты, наш «критик» тут же сообщил, что он это так сказал, для примера, и нисколько не настаивает. Вот такие «критики».
 
Место действия этого «критика»? Дискуссия на «Троицком варианте». Имя «критика»? При желании, любой может найти, он фигурирует и в трагикомедии о том, как собирали подписи против ДНК-генеалогии в массовке. Вот такие «критики» у ДНК-генеалогии. Но, как говорил вождь, «других критиков у меня для вас нет». Примерно так.
 
Анатолий А. Клёсов,
доктор химических наук, профессор
 
Перейти к авторской колонке
 

Поддержите проекты Академии ДНК-генеалогии: ваше пожертвование – это дальнейшее изучение истории наших предков, выпуск тематических книг, организация научных мероприятий, исследование палео-днк и ещё многое другое. У нас пока нет других помощников, кроме вас. Поэтому если вы считаете нашу работу полезной, нужной и можете её поддержать, то будем благодарны. Сделать пожертвование от 100 до 5000 руб. можно буквально в один клик по этой ссылке.

 

Понравилась статья? Поделитесь ссылкой с друзьями!

Опубликовать в Google Plus
Опубликовать в LiveJournal
Опубликовать в Мой Мир
Опубликовать в Одноклассники

Читайте другие статьи на Переформате:

35 комментариев: ДНК-генеалогия представителей княжеских родов гаплогруппы N1c1

  • Владимир говорит:

    Извините, немного не в тему комментарий: в центре на картинке Сергий Радонежский? Он ведь не Рюрикович, а сын ростовского боярина. Или святой как заступник, или молитвенник за династию и всю Русскую землю?

    • Михайло говорит:

      Сергий Радонежский же помирил Московских и Рязанских великих князей в конце XIV века. Благодаря ему южные и центрально-северные великороссы перестали воевать друг с другом.

    • Не стоит воспринимать картины, как приведенная здесь, столько буквально. На заднем плане видны купола церквей, но ведь они тоже не Рюриковичи, не так ли? У художника был замысел, и в соответствии с ним художник разместил композицию так, как посчитал нужным. А зрители трактуют так, как им ближе по восприятию.

      • Владимир говорит:

        Безусловно, картина отражает наиболее яркие элементы материальной культуры, по которым угадывается Московская Русь: храм Покрова на Нерли, Собор Василия Блаженного, Успенский Собор. Я, собственно, не про фон. Возможно, помимо миротворческих заслуг, у св. Сергия в окружении Рюриковичей есть и другая роль – он как символ православия на Руси, поборник единства земель, представитель Церкви, которая являлась в 14 веке, да и в последующих столетиях, союзником московских князей. Зрительное выражение концепции «Москва – третий Рим», согласно которой русский государь обязан с Божьим страхом оберегать единственное суверенное православное государство, естественно, при церковной поддержке. Возможно, эту мысль, в том числе, хотел выразить художник. А так к картине никаких претензий, очень выразительная, вписывается в тему статьи. Спасибо за пояснения!

  • CeMaPzJI говорит:

    Анатолий Алексеевич, спасибо за очередную интересную статью. Прояснил для себя некоторые моменты, связанные с гаплотипами. В ходе прочтения статьи, появились некоторые вопросы.
     
    1. Что означает «базовый гаплотип» (Рюрика)? Это усреднённый гаплотип для проверяемых потомков, либо это наиболее вероятностный гаплотип для их общего предка?
     
    2. Будут ли также подробно рассмотрены гаплотипы Рюриковичей гаплогруппы R1a1?

    • >> Что означает «базовый гаплотип» (Рюрика)?
       
      В статье нет слов «базовый гаплотип Рюрика», со скобками или без них. Есть слова «базовый гаплотип «рюриковичей», причем «рюриковичей» взято в кавычки. Для краткости в одном случае написано «Рюрик», опять в кавычках, в одной строке с гаплотипом. Более того, в статье есть пояснение:
       
      Мы вынуждены брать этот термин в кавычки, потому что, строго говоря, прямых, документальных подтверждений этому нет, хотя они, как правило, имеют четкую официальную родословную. Более того, как уже упоминалось, есть «Рюриковичи» и в гаплогруппе R1a, с таким же временем жизни общего предка, как и в гаплогруппе N1c1. Снять кавычки было бы научно некорректным, поскольку имеем две пока несовместимых ситуации.
       
      Базовый гаплотип – это не «усредненный гаплотип» для тестированных на ДНК потомков, и не «наиболее вероятностный гаплотип», хотя последнее иногда можно толковать и так, но только в отдельных случаях.
       
      Рассмотрим, например, следующую серию гаплотипов (это реальная серия из 27 гаплотипов, взятая из одного из Проектов FTDNA):
       

       
      Девять из них идентичны друг другу, это – базовые, или предковые гаплотипы. Они не успели мутировать за время, прошедшее от их общего предка (примерно с середины I тыс. н.э.). Как видно, гаплотип 13 25 16 11 11 14 12 12 10 14 11 18 – не усредненный, и не наиболее вероятный, он определяется напрямую, и представляет, так сказать, медицинский факт. Очень часто базовый гаплотип определяется именно таким образом, напрямую, и никаких вычислений при этом делать не нужно, его и так видно. Часто бывает и то, что базовый гаплотип представлен менее выраженно, но тем не менее очевиден. Именно такая картина наблюдается и у «рюриковичей», у которых на одиннадцать 67-маркерных гаплотипов в среднем по 5 мутаций на гаплотип, так что какой гаплотип был предковым, совершенно очевидно. В этих случаях «базовый» и «предковый» гаплотип являются синонимами. Но есть много и пограничных и неочевидных случаев, когда предковый гаплотип приходится получать экстраполяцией, порой неоднозначной. Обычно это бывает с гаплотипами потомков древних общих предков, или с короткими гаплотипами, или с небольшим числом гаплотипов. Что, называть получаемые гаплотипы тоже «предковыми»? Так нельзя, это была бы натяжка, а порой и неверно. Поэтому «базовый гаплотип» – это либо предковый, в очевидных случаях, либо, в случаях неочевидных, наиболее приближенный к предковому в условиях данного расчета.
       
      >> Будут ли также подробно рассмотрены гаплотипы Рюриковичей гаплогруппы R1a1?
       
      Они уже рассмотрены, как в статье на Переформате двухлетней давности, так и в книге «Происхождение славян» (М., 2013). С тех пор ничего принципиально нового, как мне известно, не появилось.

  • Liddy Groth говорит:

    Уважаемый Анатолий Алексеевич! Небольшое пояснение относительно построек «скандинавского» типа, упомянутых здесь:
     
    >> Похоже, что те, кого историки (в особенности ангажированные) принимают за «скандинавов» на Руси были на самом деле русскими, славянами, которые вполне могли иметь скандинавские мечи, возводить постройки «скандинавского» типа и привозить из боевых походов скандинавские трофеи.
     
    Вот как выглядят рассуждения российских археологов-норманистов относительно вклада скандинавов в возведение «построек» на Руси, и вообще в развитие городской жизни (пара примеров).
     
    А.Н.Кирпичников: «Ни один древнерусский город или поселение не может сравниться с Ладогой по степени сохранности своих построек… Наряду с описанными избами в Ладоге VIII-X вв. были распространены постройки и другого типа. Это относительно крупные дома общей площадью до 60-80 кв.м. Они состояли из основного отапливаемого сруба и холодной пристройки-сеней, обложенный по краю вертикально поставленными плитами. Вдоль стен тянулись нары. Крыши построек держались на слегах, врубавшихся в торцевые щипцы, и иногда поддерживались внутренними столбами. Последние использовались обычно, если размер отапливаемого сруба превышал 6х7 м и бревенчатые стены постройки не могли выдержать давление земляной кровли. Отапливались эти помещения по-черному и потолка не имели. Пристройка возводилась одновременно с домом. Она делалась из бревен или представляла собой трехстенный сруб. В ней могла находиться лестница для подъема на специальный помост. Некоторые из двухкамерных построек можно рассматривать как жилища владельцев городских усадеб. Неслучайно они, как правило, окружены хлевами, амбарами и другими хозяйственными постройками. По плану двухкамерные ладожские дома поразительно похожи на дома-пятистенки, обнаруженные археологами в Новгороде и Белоозере. Правда, последние относятся к несколько более позднему времени. Ладожские двухкамерные дома, а их в слоях VIII-X вв. открыто не менее десяти, можно рассматривать в качестве предшественников изб-пятистенок русского средневековья и нового времени. Происхождение этого типа ладожских построек, возможно, также связывать со Скандинавией, где хорошо известны аналогичные двухкамерные жилища (выделено мной – Л.Г.). Там сохранились подобные постройки, относящиеся и к XIII в. Обнаруженные при раскопках сооружения такого рода датируются, например, в Трондхейме XI в. В этом ряду ладожские двухкамерные постройки пока наиболее древние (выделено мной – Л.Г.). Для их реконструкции уместно использовать такие детали древненорвежских домов, как расположение входа не с торца, а с одной из боковых сторон холодной пристройки, а также обрамление его двумя портальными полуколоннами (Кирпичников А.Н. Ладога в первые века ее истории // Старая Ладога – древняя столица Руси. СПб., 2010. С. 68).
     
    Археолог А.А.Мурашева: «Кроме предметов, скандинавский «след» фиксируется и в других областях материальной жизни Древней Руси. Было установлено, что городская жизнь Киева изначально возникла на Нижнем городе – Подоле… А между тем принцип планировки Подола…оказывается аналогичен структуре расселения в городах средневековой Швеции, таких, например, как Сигтуна… Археологические источники показывают, что скандинавы входили в состав древнерусской элиты (причем на ранних этапах образования Древнерусского государства составляли в ней значительную, если не преобладающую часть). …Даже и этот ограниченный материал неизбежно приводит к выводу об особой роли выходцев из Скандинавии в ранней русской истории (Мурашева В.В. «Путь из ободрит в греки…» Археологический комментарий по «варяжскому вопросу» // Российская история. № 4, 2009. С. 177).
     
    Как видите, логика норманистских рассуждений стоит на голове и пытается есть пятками. Ведь если названные двухкамерные постройки в Ладоге на несколько столетий древнее тех, что в Трондхейме, то нормальнее предположить, что подобные строительные традиции были принесены из Восточной Европы в Трондхейм, а не наоборот. К тому же, причем здесь Трондхейм, если, согласно Е.А. Мельниковой, скандинавских пришельцев на Русь отличала относительная этническая однородность: «подавляющее их большинство было выходцами из Свеяланда» (Мельникова Е.А. Скандинавы в процессх образования Древнерусского государства)?
     
    Относительно параллелей между Киевом и шведской Сигтуной, то они еще нелепее. В одной и моих последних статей «Древнерусские города: при чем здесь скандинавы?» я привела данные шведских медиевистов о Сигтуне: процесс урбанизации в этом населенном пункте получил развитие в XIII в., но археологические данные свидетельствуют о существовании здесь нескольких населённых пунктов с более раннего периода, причем некоторые из них могли развиться и в предгородские поселения. Королевская ставка была переведена сюда уже в 980 г., но тип застройки, характерной для плотно населённого пункта, прослеживается в Сигтуне в XI в., есть свидетельства о развитии торговли и ремесла. Т.е. то же самое, что и с ладожскими постройками: развитие Сигтуны как города начинается в более поздний период, чем Киева, но мир норманистов перевернут вверх ногами.
     
    Законный вывод: никаких построек «скандинавского» типа на Руси не было. Наоборот, сейчас уже совершенно очевидно, что процессы урбанизации в странах Скандинавского полуострова испытывали большое влияние со стороны, в частности, из Восточной Европы и южнобалтийского побережья.

    • Виктория В.С. говорит:

      Вообще не понимаю, почему у этого двухкамерного строения непременно должна быть преемственность. Всё равно в какую сторону. Такое решение диктовалось, прежде всего, климатом, не требовалось никакого ума или даже заимствования, чтобы придумать такое жилище. Отмечу, что в русском (континентальном) климате такая конструкция полезна круглый год. Зимой эти сени помогают сохранять тепло, но круглый год полезны для хранения продуктов. Для этого тоже великого ума не надо, чтобы придумать чуланчик и погреб.

      • Liddy Groth говорит:

        И я тоже не понимаю. Но идею «преемственности», идущей строго от скандинавов на Русь, внедряют норманисты, причем берут не уменьем, а числом. Поэтому приходится тратить время на то, чтобы показывать, что если уж рассуждать о преемственности, то хотя бы не выходя за рамки логики.

        • Виктория В.С. говорит:

          Конечно, многие бытовые предметы и решения люди придумывали в разных местах самостоятельно, как бы «с нуля». Исходя из целесообразности. Многие при этом автоматически оказывались похожими или однотипными.
           
          В приведенной Вами цитате про дома из Ладоги из Кирпичникова А.Н. меня особенно умиляет предложение …Для их реконструкции уместно (выделено мной) использовать такие детали древненорвежских домов, как расположение входа не с торца, а с одной из боковых сторон холодной пристройки, а также обрамление его двумя портальными полуколоннами… Такую ерунду может написать только городской кабинетный «научный работник». Зачем древняя Норвегия? Нужно съездить в русскую деревню. Там до сих пор такие избы стоят. И в сенях обычно две двери. Одна на торце для выхода в огороженый двор к хозяйственным постройкам, а вторая сбоку на улицу с крыльцом (и лавкой для «посиделок») для входа гостям. И ничего в этом, кроме целесообразности, нет.
           
          Один боковой вход имеет смысл в жилом доме без хозпостроек, или если дом стоит на улицу задней стеной. Это точно нерусский вариант)). У нас должно быть и крыльцо, и занавесочки на окнах, и ставни резные, и петухи на крыше…

          • Liddy Groth говорит:

            >> Такую ерунду может написать только городской кабинетный «научный работник».
             
            При этом, не один. Их много, этих «научных работников».
             
            >> Зачем древняя Норвегия? Нужно съездить в русскую деревню. Там до сих пор такие избы стоят.
             
            А «научные работники» Вам объяснят, что и на деревню простирается влияние построек «скандинавского типа». Мне на днях показали статью одного сторонника идеи «экспансии викингов на Русь», где так и написано, что разные группы скандинавов «руси» постепенно сформировали сеть эмпориев (торгово-ремесленных поселений) в ключевых узлах международной дальней торговли (Ладога, Гнездово, Киев). Если такому «работнику» видится сеть, то тут уже комар мимо не пролетит: не только двухкамерные дома, но и любую постройку вплоть до последней избы под общий скандинавский знаменатель подведут. Правда, данное лицо служит в отделе, которым руководит одна из известных норманисток.

            • Виктория В.С. говорит:

              Про эту «сеть» пишут уже несколько лет. Это от экономической безграмотности ставят телегу впереди коня. Никакая дальняя торговля (и сейчас, и тысячу лет назад) не станет создаваться и не сможет развивается там, где нет сильной местной власти. Фактически она формируется «по лицензии» этой власти и под её «зонтиком». У любого «дальнего бизнеса» есть ахиллесова пята – им можно управлять в какой-то степени и получать доход, но владение им, как собственностью весьма условно. Всё, что создано на удалённой территории никуда с собой не увезёшь, оно без особых усилий может быть «национализировано или экспроприировано». Тем более 1000 лет назад. У руси, если она была пришлая (неважно какого происхождения) не могло быть ресурса для организации и монополии в таком бизнесе… Князь Игорь, однако, поплатился головой за желание получить больше дани. Может, это и сказка, но автор полагал допустимость такого сценария.

              • Liddy Groth говорит:

                Согласна с Вами. Кроме того, «сеть» – плод нечестивого союза шведского политического мифа и вольно интерпретируемых сюжетов из исландских саг. Поэтому при «сети» и коня нет, одна телега, вернее воз, который творцы «сети» пытаются двигать силой своего воображения, но он «и поныне там». Про «сеть» я продолжу писать и в следующей статье о парусе у скандинавов, поскольку для раскидывания «сети» нужны были, худо-бедно, соответствующие плавсредства, а их-то и не имелось.

              • Леонид говорит:

                О нелогичности/невозможности такой экономики – сквозной торговли скандинавов через наши просторы с греками, писал ещё Сергей Лесной: не было у скандинавов такого интересного для греческих покупателей товара, что мог бы окупить расходы по его перевозке из Скандинавии в Грецию, с оплатой «таможенных пошлин» при провозе через все границы многочисленных славянских племён.
                 
                Вот цитата из книги Сергея Лесного «Откуда ты, Русь?»: «…Нужно помнить об опасностях торговли в те времена. Главное же то, что огромные расстояния съедали все выгоды транзитной торговли, даже если бы она была физически осуществимой. Товаровместимость ладей была ничтожна: дикость путей, огромные расстояния требовали перевозки больших количеств пищи, платья, оружия, инструментов и т.д. Длинные волоки посуху ставили торговцев в полную зависимость от окружающего населения, которое, конечно, всегда было готово погреть руки. Если в древности так сильно грабили своих, то что говорить о чужих?
                 
                Можно утверждать с полной ответственностью, что никакой транзитной торговли с Востоком не было. Торговый путь распадался на участки, где происходила продажа и покупка прибывших товаров. Достоверно известно, что скандинавские купцы до устья Волги не доходили. Да и не могли доходить. Торговля на Руси осуществлялась самими руссами. Сторонникам транзитной норманской торговли стоит лишь взять карандаш в руки и подсчитать, сколько тысяч километров пути и месяцев необходимо для доставки одного килограмма из Швеции хотя бы до средней Волги, чтобы понять, что не существовало в то время товара, который мог бы оправдать свою перевозку экономически.
                 
                Иностранные товары (в очень незначительном количестве) непременно проходили через руки русских купцов. Надо помнить к тому же, что правитель каждого государства, через границы которого проходили чужие товары, брал 1/10-1/8 часть их. Границ было множество. В этих условиях из Скандинавии до устья Волги могли доходить лишь жалкие остатки первоначального товара. К тому же водная дорога открывалась лишь в апреле, а в октябре на севере речки уже замерзали.
                 
                Неудивительно поэтому, что в первые века истории мы не находим на Руси ни западноевропейских товаров, ни денег, ни, наконец, упоминаний о скандинавских купцах. Нет ни единого отчета хотя бы об одной поездке скандинавского купца на Черное или Каспийское море».

  • Максим говорит:

    Доброго времени суток, хотел бы подать заявку, прошу прощение за оффтоп. С Ув. Максим.

  • Ira говорит:

    Надо, впрочем, сказать, что народа «славяне» нет, это просто фигура речи, региональное, географическое понятие.

    • Если следовать этой «логике», то нет никакого народа. Что, к французам это не относится? К немцам, испанцам, китайцам? Как насчет англичан, ирландцев, шведов? Может, дадите строгое определение «народа»? Тогда можно продолжить. Это было раз. Теперь – два. Слово «славяне» в статье выше употреблено восемь раз, слово «народ» – четыре раза. Ни разу они не приведены вместе. Тогда Вы, собственно, о чем?

  • читатель говорит:
    • Вы цитируете мою же (в соавторстве с И.Л. Рожанским) статью из Advances in Anthroplogy, что такой же 12-маркерный гаплотип, как и у меня, есть в субкладе Z93. Ничего удивительного в этом нет, мой Z80 и цитируемые Z93 на первых 12 маркерах неразличимы. Различия появляются при удлинении гаплотипов. Потому-то индийские Z93 так похожи на русские Z280, потому что их общий предок жил всего на несколько сот лет ранее их общих предков.

      • Slava говорит:

        Это был любопытный «читатель», Анатолий Алексеевич, а вот Вам некий юный критик-писатель И.Чернышев, легко найти на Гугле по ключевым фразам, ну почти Чернышевский. Еще и знаток ДНК-генеалогии. Довольно настырно обличает всех, Задорнова, Грот, Рожанского, Вас. Утверждает, что о Вашей родословной и «генетических тестах» известно не много. Найти инфу о митохондриальной (полученной от матери) гаплогруппе Клёсова мне не удалось… нет снипа M17, и об этом я когда-то читал на форумах. Ариец определенно получился какой-то недоделанный и нам всем (тем у кого R1a1a) указует пути индивидуум у которого даже нет M17». Злопыхает парниша также и по поводу ваших предков. Размажьте, пожалуйста, светило литературы чукчу-писателя, надоело натыкаться на интернете.

        • Ему надо к психиатру, а у меня другая профессия. И вообще, много чести таким уделять персональное внимание. Но я сейчас готовлю материал, о котором скоро сообщу, и там для таких найдется место, коллективное.

          • Slava говорит:

            Может быть, Вы помните, я был против потери времени в каких-либо перепалках с посторонними. А сейчас уже как бы и скучно без пальбы. Вот и подбросил Вам последних воробьев. Уж как-то легко Вы расправились со специалистами в ДНК генеалогии «бандой 24-х», все, правда, из «не читала, но осуждаю», точно как в circa 40х-60х годах прошлого столетия. На десерт за это время были и пара «братских могил» с сотней авторов, из которых кое-кто должен быть и в курсе. Надо признаться, я не ожидал такого разгрома!

            • «Я вот думаю, что сила в правде. У кого правда — тот и сильней…» ©
               
              Понимаете, уважаемый Slava, разгром должен увенчаться не декларацией разгрома, а нечто более существенным. Вся эта недостойная орава, если называть вещи своими именами, все эти балановские, клейны, касьяны, боринские, шнирельманы, маркины – на поверку оказались банальным жульём. Вот типичные методы их работы – прошла (ноябрьская) конференция в РАН, они пытались устроить грубый саботаж, в итоге мой доклад прошел под аплодисменты, и Балановских выгнали из зала. Что они сделали? Тут же тиснули статью под названием «Провал ДНК-генеалогии в РАН». Разве у них может быть правда, а значит, сила?
               
              Еще пример. После той же конференции Балановские состряпали фальшивую «резолюцию» нашего круглого стола, выставили ее на сайте Балановской в РАМН и тиснули в Википедии, на «моей» страничке (в очередной раз напоминаю, что я эту страничку не писал и править не намереваюсь, пусть их дурость каждому будет видна; особенно в вандализме странички отметился лингвист Касьян, кандидат наук, который ищет «прародину» индоевропейцев, и, видимо, взъелся на меня за то, что я элементарно показал, что никакой прародины ИЕ нет и быть не может). Но среди читателей и комментаторов поднялся шум, и модераторам Википедии пришлось ту фальшивку Балановской удалить. Опять оказалась ложь Балановской. Разве у нее может быть правда, а значит, сила?
               
              У этой истории с лживой Балановской есть продолжение. Недавно опубликована – наконец – резолюция той конференции, и на сайте той же Балановской с негодованием выступил коллектив из шести человек – любят они коллективные письма писать, старая привычка. Вот эти шесть человек – Балановская, Брилева, Дыбо, Касьян, Клейн, Кулланда. Оказалось, автор резолюции от себя дописал несколько страниц текста, напирая на то, что карачаево-балкарцы – потомки алан. Это вызвало бурное возмущение подписантов, и они обрушились и на автора (которого они пытались вычислить), и на алан, и на карачаево-балкарцев, и на конференцию, назвав ее «печально нашумевшей». Занятно, не так ли? Сами на конференции устроили скандал, сами опозорились и оскандалились, самих выгнали из зала (после этого, кстати, Балановские на конференции не появлялись, как и на праздничном ужине, понимая, что они там не welcome). И вот теперь они же и обозлены на конференцию. Более того, они встали в позу, алан как предков КБ больше не признают – цитата «Ну что им сдалась эта преемственность от аланов?», и продолжают – «Почему им так необходимо непременно установить официально происхождение своего народа от аланов, чем им так не угодили «обычные» тюркоязычные предки — кыпчаки (половцы) и др.?». Иначе говоря, эта убогая шестерка вдруг решила поддержать название моей статьи на «Переформате» – «Современные потомки половцев – карачаевцы и балкарцы?», хотя у меня там стоял всего знак вопроса. Но мне эта поддержка не нужна, уж слишком отталкивающи «поддержанты».
               
              Так вот, самое забавное то, что Балановская и подписанты при построчном анализе резолюции не вернулись к фальшивке Балановский. Отметили всё, что им казалось в новой версии не так, а ДНК-генеалогию тронуть побоялись. Ни одного негативного слова не вставили. Видать, руки-то им действительно поотбивали. Так что, уважаемый Slava, Вы правы – разгром был действительно полный, и это не я сказал, а они сами молчаливо признали.
               
              Но у разгрома должен быть яркий конец. И я его сейчас готовлю. Поделюсь. Сейчас я пишу книгу под названием «Кому мешает ДНК-генеалогия», и в ней «поименно вспомню тех, кто поднял руку». В книге будут сто вопросов и ответов о ДНК-генеалогии, что подведет базу про то, почему и кому мешает ДНК-генеалогия. Другими словами, я строю материал на примерах глупых и негативных комментариев, и это дает мне возможность не только размазывать по стенке безграмотных и злонамеренных Балановскую, Балановского, Клейна, Касьяна, Боринскую, Тетушкина, Веренича, Запорожченко, Лебедева, Маркину и прочих «подписантов» и «критиков», но подавать материал ДНК-генеалогии в наглядном виде. Более того, чтобы сделать книгу еще более интересной и информативной, я персонально прохожусь по всем 24-м подписантам того лживого письма, и на конкретных примерах из их «исследований» показываю, чем им мешает и почему им не угодила ДНК-генеалогия. Думаю, это будет весьма познавательно.
               
              Например, та же новоиспеченный доктор наук Кашибадзе, которая на основании строения зубов ископаемых «донских алан» якобы показала, что они были предками карачаевцев, хотя, во-первых, те донские аланы оказались вовсе не предками карачаевцев, и, во-вторых, те якобы сходства были совершенно взятыми с потолка, потому что никакого сходства там не было, те «сходства» были невоспроизводимы и гуляли по всему полю. Однако это не помешало Кашибадзе, глядя на нестыкуемые и несовместимые данные, делать якобы выводы об аланах как предках карачаевцев, и строить на этом наиболее «выигрышную» часть своей докторской диссертации. Понятно, что данные ДНК-генеалогии для нее как кость в горле, и, как объявила Балановская на упомянутой конференции, Кашибадзе отдала время своего доклада Балановской, как выяснилось, для агрессивной атаки на ДНК-генеалогию и на меня лично.
               
              Эту книгу я буду частично публиковать на Переформате, опять же как пособие по ДНК-генеалогии, и как наглядную иллюстрацию, что сейчас из себя представляют «ученые», которые набросились на ДНК-генеалогию, чем и как они сами занимаются, и какую «науку» представляют. Скучно не будет. Вот это и будет яркий конец разгрома. То, в чем наука действительно нуждается. И чтобы другим было не только неповадно, но и страшно строчить обвинительные лживые пасквили. Чтобы знали, что аукнется.

              • Виктория В.С. говорит:

                Анатолий Алексеевич! Я к числу тех, кому мешает ДНК-генеалогия в России, отношу политологов и социологов (и соответственно, практических политиков, которых в высших эшелонах непропорционально больше, чем в народе) западного толка.
                 
                На самом деле «неудобную» и «ненужную» информацию открыли сами попгенетики. А с тех пор занимаются тем, что «наводят тень на плетень». ДНК-генеалогия, сосредоточенная на реальных данных, «плоха» тем, что стимулирует мыслительные процессы. И рано или поздно это «прорастёт» глубинным осознанием того, что «разные цивилизации» – это не фигура речи. Что население Евразии тысячи лет было разделено на несколько кластеров, в которых формировались относительно независимо самостоятельно цивилизационные компоненты. Относительно, потому что взаимодействие (и взаимовлияние) было. Но оно всегда подвергалось переработке (перевариванию) собственной средой. Потому что никак иначе это не может происходить. На эту тему есть очень глубокое философско-литературное произведение С.Лема «Солярис». О взаимодействии двух «разумов». Один из них, чтобы начать «общение», посылал человекоподобных существ (извлечённых из человеческого мозга, не понимая, что это болевые воспоминания), а другой сходил от этого с ума и в ответ «посылал» рентгеновское излучение.

                • >> Я к числу тех, кому мешает ДНК-генеалогия в России, отношу политологов и социологов (и соответственно, практических политиков, которых в высших эшелонах непропорционально больше, чем в народе) западного толка.
                   
                  Большинство из них и не слышали про ДНК-генеалогию, поэтому она им вряд ли пока мешает. Но мысль Ваша по сути верная, и вот в каком отношении. Действительно, среди «интеллигенции», к которой политологи и социологи себя, безусловно, относят, есть заметная доля тех, кто с удовольствием называют себя (или с удовольствием откликаются на название) «западного толка» или «западной ориентации». Они выставляют себя радетелями России, потому что – по их пояснениям – если Россия примет западные условия (или условия Запада), то она прямо расцветет. И чтобы это было, они демонстративно являются жесткими (или мягкими – кто как) критиками современного российского (независимого) политического курса. ДНК-генеалогия здесь тоже вроде бы ни причем, но это только на первый взгляд. При любой направленной дискуссии с ними выясняется, что их мировоззрение простирается гораздо глубже вопросов современной России, оно «западное» всегда и во всем. Выясняется, что практически все они «норманисты», и ментально не подпускают древних славян ни к ремеслам, ни к военному делу, ни к науке, какой бы смысл в это ни вкладывать. В их системе координат это всё делали «скандинавы», «немцы», «французы», «испанцы», потому что славяне всегда – по их, «западников», мнению, были тупыми, примитивными, ленивыми, в общем, быдлом. Это они придумали про «аннексию» Крыма, и если не придумали, то подхватили. И вот здесь ДНК-генеалогия начинает им мешать. Она ломает их стереотипы, которые они переняли у других и сами пытаются навязывать. ДНК-генеалогия не оставляет места норманизму. На все попытки показать глубокую историю славян они всегда с издевкой отвечали – «Да, конечно, Россия – родина слонов». Это их любимая поговорка. А ДНК-генеалогия и это ломает. Они с удовольствием подхватывают, что человечество вышло из Африки, им бы откуда угодно, только, не дай Бог, чтобы с Русской равнины. А ДНК-генеалогия и здесь ставит крест на «африканском происхождении человечества». Опять мешает. Они в возмущении, что арии прошли по Русской равнине, и что гаплотипы современных этнических русских гаплогруппы R1a к ним, ариям, оказались очень близки. У них все нутро от этого страдает. Вот когда ДНК-генеалогия им мешает.
                   
                  Есть на свете филолог, академик А. Зализняк. Так он, критикуя Велесову книгу, заявил, что русским не нужна древняя история. Потому что, оказывается, поощряет русский национализм. Вот оно как! Всем народам древняя история нужна, Зализняк против этого не возражает. Он не выступил, например, против древней истории евреев, там все в порядке. А вот русским – низзя! А ДНК-генеалогия показывает древнюю историю русского народа. Мешает. Мешает Клейну, у которого со славянами свои счеты, как следует из его высказываний. Мешает Шнирельману, который считает русский патриотизм вредным, цитаты я давал ранее здесь, на Переформате. Потому Шнирельман принял участие в составлении фальшивой резолюции Балановской, которая «осуждала» ДНК-генеалогию. Замечаете систему? Вот им ДНК-генеалогия всем мешает. Поэтому противостояние будет продолжаться. Потому я и пишу сейчас книгу «Кому мешает ДНК-генеалогия». В этом противостоянии пора перехватывать инициативу.

  • Сергец говорит:

    Slava, если размазывать каждое г., то будет только больше вони, присоединяйтесь лучше к группе адекватных людей – ДНК-генеалогия как историческая наука, если вы еще не там, всем интересующимся рекомендую: http://vk.com/club86388164

    • Посмотрел, отличный сайт. Прекрасно оформлен, много интересных и разнообразных материалов. Только выпроваживайте деструктивных людей, если появятся. У них простой алгоритм – они резко критикуют, всем недовольны, но ничего своего не предлагают. Они, конечно, поднимают визг, что, мол, никакой демократии. Пусть поднимают, на это нельзя поддаваться. «Демократия» без конструктивного подхода – это охлократия и деструкция.

  • Сергец говорит:

    Спасибо за оценку и поддержку, уважаемый Анатолий Алексеевич! Конечно, так и было задумано изначально – максимальная свобода при соблюдении правил и ориентация на саморегулирование, но это было задумано когда группа имела закрытый статус, теперь же ситуация изменилась, группа является открытой и, соответственно, возникает вероятность попадания деструктивных людей, при этом, нам нужны оппоненты, но если они будут переходить грань конструктивного участия и нарушать правила, то без особых церемоний будут отправляться в бан.

  • Алексей Татарников говорит:

    Уважаемый Анатолий Алексеевич! Вопрос по прочтении «Арийских народов…». Определял ли кто-нибудь гаплогруппы ископаемых останков из Мохенджо-Даро? Может быть, ключ хоть какой к дешифровке письменности появился? И немного прояснился вопрос о двух волнах миграций R1a из Европы.

    • >> Определял ли кто-нибудь гаплогруппы ископаемых останков из Мохенджо-Даро?…И немного прояснился вопрос о двух волнах миграций R1a из Европы.
       
      По первому вопросу – нет, в Индии ископаемые гаплотипы не изучали. В отношении двух волн миграции R1a из Европы – это пока общие рассуждения или слабые догадки, выбирайте что хотите. На них (две миграции или несколько, или одна, растянутая на тысячелетия) намекают (не более того) древняя керамика, обнаруженная в юго-восточной Азии за тысячелетия до исторических ариев начала-середины II тыс. до н.э., но характерная для предполагаемых носителей R1a в Европе; материальные признаки из Мохенджо-Даро (Индия), характерные для носителей R1a, но задолго до исторических ариев; наличие предполагаемых носителей R1a в афанасьевской культуре задолго до исторических ариев, носителей R1a, и обнаруженных в тагарской и таштыкской культурах с намного более поздними датировками (первые 3800-3400 лет назад, вторые позже) и в таримском бассейне (4000-3800 лет назад).
       
      Слабые догадки – потому что датировки у археологов часто «по понятиям», синхронизованные, как они говорят, с тем, что они датировали ранее, опять же часто «по понятиям». Радиоуглеродные или другие объективные методы датировок они используют относительно редко, и датировки часто передвигаются при более пристальных рассмотрениях. На мой запрос археологи ответили, что афанасьевскую культуру никто фактически не датировал, всё опять же «на пальцах». Поэтому и датировкам часто доверия мало, и гаплотипы в тех краях часто известны короткие (протяженные гаплотипы попгенетики не определяют), без снипов. В таримской находке гаплотипы вообще не сообщались, снипы неизвестны. Вот потому сравнивается малопонятно, что малопонятно с чем. В такой ситуации «прояснения» вопроса еще какое-то время не будет.

  • И. Рожанский говорит:

    >> В таримской находке гаплотипы вообще не сообщались, снипы неизвестны.
     
    Недавно их типировали на снип Z93, оказался отрицательным. Один из авторов статьи сообщил об этом в комментарии, опубликованном в июле 2014 года: Xiaohe R1a1a more likely originate from Europe because of it not belong to R1a1a-Z93 branch (our recently unpublished data). Других данных пока нет.

  • >> Недавно их (таримские находки) типировали на снип Z93, оказался отрицательным. Один из авторов статьи сообщил об этом в комментарии, опубликованном в июле 2014 года…
     
    Здесь какое-то недоразумение. Для начала, статья 2010 года, на которую дается комментарий, субклад R1a-Z93 вообще не упоминает (комментарий выше не о ней, это просто для сведений). В 2010 году субклад Z93 вообще был неизвестным. Вот как выглядела диаграмма субкладов R1a в 2010 году (синонимные и параллельные снипы сокращены):
     
    • • R1a M420
    • • • R1a1 SRY10831.2
    • • • • R1a1a M17, M198
    • • • • • R1a1a1 M417
    • • • • • • R1a1a1a M56
    • • • • • • R1a1a1b M157
    • • • • • • R1a1a1c M87
    • • • • • • R1a1a1d P98
    • • • • • • R1a1a1e PK5
    • • • • • • R1a1a1f M434
    • • • • • • R1a1a1g M458
    • • • • • • • R1a1a1g1 M334
    • • • • • • • R1a1a1g2 L260
     
    Так что с 2010-м годом разобрались, чтобы не было недоразумений.
     
    Переходим к комментарию на ту статью (комментарий был дан в августе прошлого года). Достаточно посмотреть на имя-фамилию того, кто дал комментарий, чтобы дальше не читать. Но мы прочитаем, уже начав посмеиваться. Имя его – Clyde Winters, из некоего института африканских исследований из Чикаго, под названием Uthman dan Fodio Institute. Никаких экспериментальных исследований в нем не ведется, как не проводится и никаких расчетов. Этот институт выполняет чисто идеологическую задачу – он промотирует идею того, что всё на свете вышло из Африки, под это и получает финансирование. Clyde Winters, понятно, тоже чернокожий, хотя в этом ничего зазорного нет. Похоже, что он единственный сотрудник в том институте. Он занят тем, что пишет бесчисленные статьи о том, что все гаплогруппы вышли из Африки, причем данные откровенно подделывает или передергивает. Серия статей у него о том, что гаплогруппа R1b вышла из Африки, и что доля гаплогруппы R1b в Африке близка к 100%. Вы понимаете, почему я уже начал посмеиваться, когда увидел его фамилию как автора комментария?
     
    Кстати то, что гаплогруппа R1b в Африке близка к 100%, он списал из другой статьи, в которой тестировали плантаторов в ЮАР. Это они, белые, потомки буров, имели около 100% гаплогруппы R1b. А Winters «списал», что «100% в Африке». То же самое по многим другим примерам, у меня в журнале Advances in Anthropology (2014) было довольно подробное рассмотрение ряда его работ, со ссылками, они все такие.
     
    Так что тестировать таримцев на снипы и узнать, что там нет Z93, Clyde Winters попросту не мог, если, конечно, к кому-нибудь не присоседился, но кому он нужен?
     
    Теперь смотрим на комментарий этого «знатока» к статье про таримцев 2010 года. Сначала – мелочи, на совести Clyde Winters. Ничего из перечисленного ниже он не знает и знать не может, но с обычной для него категоричностью он разбрасывается своим «знанием»:
     
    — The Afanasievo culture never reached the Tarim Basin.
    — there is no evidence of Indo-Europeans in Tarim Basin before 500BC.
    — there is no evidence of western Eurasians in Central Asia
    — there is abundant evidence of Dravidian speakers in the region [8-10] (ссылки, конечно, на самого себя).
    — The Dravidians founded the Indus Valley civilization [10,13-15] (ссылки 10, 13 и 14 – на самого себя, в последней ссылке нет года публикации).
    — The Dravidian speakers originated in Africa, in modern day Sudan [11-12] (обе ссылки, конечно, на самого себя).
    — … there are Islands of Dravidian speakers in … Russia [10] (ссылка, конечно, на самого себя).
    — R1a probably originated in Africa… [3,5-6] (ссылки на авторов, которые об этом вообще не говорили – это Pamjav; Sengupta; Sharma) .
    — Hui Zhou claims that R1a-Z93 is probably of western origin, but, this is highly unlikely.
    — R1a is not associated with a particular culture…
    — The Z93 y-chromosome is spread from Egypt-Sudan, all the way to Siberia in western Europe.
    — clear that the Xiaohe mummies carry R1a, the clade was Z93, because there is no evidence of western Europeans in Central Asia until after 500 BC.
     
    Каждая цитата здесь – это или перл, или откровение. Мне особенно понравилось, что «Z93 распространились из Египта-Судана вдаль до Сибири в Западной Европе». Ну, и то, что R1a «вероятно появились в Африке» – тоже неплохо, но блекнет по сравнению с Сибирью в Западной Европе.
     
    Но то, что таримцы не имеют Z93, у него нет. Наоборот, он считает, что есть, но на основании занятного положения – что это должно быть так, поскольку людей из Западной Европы в Центральной Азии не было до середины 1-го тыс. до н.э. А Z93, по его представлениям, встречается исключительно в Центральной Азии. Вообще о Clyde Winters не стоило бы и упоминать, он того не стоит, но как анекдот дать можно.

    • И. Рожанский говорит:

      >> Вообще о Clyde Winters не стоило бы и упоминать, он того не стоит, но как анекдот дать можно.
       
      А я о нем и не упоминал. Приведенная выше цитата – из комментария профессора Чжоу, заведующего Лабораторией древней ДНК Цзилиньского университета (г. Чанчунь). Под его руководством, собственно, и проводили анализ таримских мумий, а также многих других захоронений на территории Китая. Видимо, Вы не заметили его пост в потоке словонедержания «эксперта» из Чикаго. Введите в контекстный поиск эту строку и прочтите весь комментарий основного автора статьи о таримских мумиях:
       
      Hui Zhou (2014-07-18 16:14) Jilin University
       
      Хоть ключевая фраза там довольно хитро завернута в стиле Chinese English, из нее однозначно следует, что мумии дополнительно типировали на Z93, но результаты (Z93-) пока не опубликованы.

      • >> Вообще о Clyde Winters не стоило бы и упоминать, он того не стоит, но как анекдот дать можно
         
        >> А я о нем и не упоминал.
         
        Разумеется, нет. Это я упоминал, хотя он того не стоил. Поскольку он своим комментарием про R1a, вышедших из Африки и добежавших до Сибири в Западной Европе, забил всё, то я действительно не заметил комментарий китайца с элегантным именем. Но если таримские мумии действительно окажутся с негативным Z93, то это вернет историю R1a в интересное русло, из которого ее выбила работа, что все R1a на востоке должны быть Z93. Возможно, что R1a действительно прибыли из Европы ранее появления там Z93, либо это вообще древнейшие автохтонные R1a, предки которые в Европе вообще не были.

Подписывайтесь на Переформат:
 
Переформатные книжные новинки
   
Конкурс на звание столицы ДНК-генеалогии
Спасибо, Переформат!
  
Наши друзья