Перед нами – очередной опус популяционных генетиков, на днях опубликованный в журнале Genome Research (Геномные исследования). Как водится в последнее время – в статье тьма соавторов, а именно ровно сто (100). Среди них, естественно, и Балановские – как же без них. Но поскольку статья откровенно провальная, то их присутствие там совершенно естественно.
 

 
Статья называется «Недавнее бутылочное горлышко Y-хромосомного разнообразия совпадает с глобальным изменением в культуре». Поскольку попгенетики обожают называть свои статьи броско и непонятно, и эту непонятность они так и не объясняют вплоть до конца статьи, как правило, вязкой и сумбурной, то приходится с самого начала заниматься расшифровкой. Попробуем…
 

Поддержите проекты Академии ДНК-генеалогии: ваше пожертвование – это дальнейшее изучение истории наших предков, выпуск тематических книг, организация научных мероприятий, исследование палео-днк и ещё многое другое. У нас пока нет других помощников, кроме вас. Поэтому если вы считаете нашу работу полезной, нужной и можете её поддержать, то будем благодарны. Сделать пожертвование от 100 до 5000 руб. можно буквально в один клик по этой ссылке.

 

Смотрим в Абстракт статьи, который по общепринятым понятиям должен состоять из самых главных положений публикуемого материала. Абстракт в данном случае состоит из восьми строк. Не густо. Но поскольку попгенетики писать Абстракты тоже не умеют, то они обычно помещают туда не то самое главное, что получили, а что делали. Типа «изучали то-то и то-то». Это как «мы собирали грибы». А сколько собрали? «Да мы собирали». А в Абстракте должно стоять: собрали 10 кг грибов. Тогда это главный результат. А «собирали» – это не результат. Но поскольку у попгенетиков нет научной школы, то они и этого не знают, даже как Абстракты писать.
 
Вообще статья чудовищно запутанная, в ней нет никакой последовательности, нет единой нити повествования. По сути, нет цели. В кучу свалено все на свете, номенклатура субкладов устаревшая, как авторы указывают – 2002 года. Поэтому опять приходится расшифровывать, гадать, что сейчас эти индексы могут обозначать, типа субклады А2, А3, B4, B5, E2a1, E2a2, E2a3, E2b3, E4, C2a2a, C3c1a, C3c2, C3g, C3i, C3h, C3f1, C5a, G2a4, I1c, I1g, I1e, I1f, I2e, I2d, I3, J1c, J1b3, J1b4, J1b5, J1b6, J1b7, J2a3, J2a4, J2a6, J2a7, J2a8, J2a9, J2a10, N2a1, N3a1, N3a2, N3a3, N3a4, N3a5, N3b, N4, O1c, O2a2, O3e, O3i, Q2a, Q2c, Q3, R1a1b, R1a1c, R1a1d, R1a1e, R1a2, R1a2b, R1a2c, R1a2d, R1a3, R1b2, R1b3, R1b5, R1b6, R1b8, R1b11, R1b13, R1b15, R1b17, R1b18, S2, S3a1… Ничего этого в современной номенклатуре нет, это вышло из употребления больше десяти дет назад. Вот теперь представьте работу с этой статьей, с этой расшифровкой. О чем авторы думали? О чем думали те же Балановские? Да ни о чем, они же «кушать подано», никто их и не спрашивал.
 
Возвращаемся к Абстракту. В нем всего пять фраз. Первая – что неафриканские популяции «вышли из Африки» 50-100 тысяч лет назад. Откуда это? А просто так. Никаких объяснений ни здесь, в Абстракте, ни вообще в статье нет. Зачем внесли в Абстракт, когда никаких доказательств этого в статье нет, это просто постулировано? А просто так. Популяционные генетики же. Мы еще к этому вопросу по Африке вернемся. Вторая фраза – это опять типа «грибы собирали». Сообщает, что в статье представлено исследование 456 Y-хромосомных последовательностей, из них 299 новых образцов. Опять, заметьте, не то новое, что получили, а что исследовали. Третья фраза – приемлема, что датировали время общего предка «в Африке» 254 тысяч лет назад, с погрешностью между 192 и 307 тысяч лет назад. Опять – не в Африке общего предка, а общего предка гаплогруппы А00. Где он в то время жил – никому не известно. Это сейчас носители А00 живут в Камеруне, и на самом деле имеют общего предка примерно 400 лет назад. А где он жил 200 тысяч лет назад – никто не знает.
 
Приведу простой пример. Сейчас в том же Камеруне живут носители гаплогруппы R1b, c общим предком 4500 лет назад. Они ушли в Африку, скорее всего, с маршрута миграции гаплогруппы R1b по Северной Африке на запад, примерно 5000 лет назад. По снипам, основатель гаплогруппы R1b жил примерно 20 тысяч лет назад. Что, в Африке? Нет, конечно. Они просто пришли в Африку относительно недавно. Иначе говоря, общий предок гаплогруппы жил вовсе в другом месте, вне Африки, скорее всего, в Южной Сибири, на что указывают там ископаемые гаплотипы гаплогруппы R.
 
А попгенетики берут совершенно аналогичный пример, а именно группу людей в Камеруне, чей общий предок жил 400 лет назад, смотрят на их снипы, и объявляют, что основатель гаплогруппы 254 тыс. лет назад «жил в Африке». Откуда это? А так, «по понятиям». Ровно никаких доказательств к этому нет, как нет доказательств «что в Африке» у основателя гаплогруппы R1b в примере выше. И вот так всё у популяционных генетиков.
 
Продолжаем препарировать третью фразу Абстракта. В ней говорится о том, что авторы обнаружили «кластер» неафриканских гаплогрупп, которые образовались в интервале 47-52 тыс. лет назад, и что это «соотносится» с моделью быстрой колонизации Евразии и Океании после выхода из Африки. Как, откуда? Данные совершенно ничего о таком не говорят. Ни о «выходе из Африки», ни о «быстрой колонизации». И вообще, что такое «быстрая колонизация»? Понятно, что эти гаплогруппы расселились по миру, а уж там медленно или быстро – это вопрос вкуса. На самом деле мы с И.Л. Рожанским нашли, что неафриканские гаплогруппы, для начала гаплогруппа ВТ, она же «бета-гаплогруппа», образовалась 64±6 тыс. лет назад, и никакого отношения это к Африке не имело (Advances in Anthropology, 2012). Гаплогруппа В отстоит от гаплогруппы А на 123 тысячи лет, и ясно, что она из гаплогруппы А не могла образоваться. Об этом же говорит и филогения гаплогрупп. А то, что этот «кластер» (на самом деле не кластер, а гаплогруппа ВТ) образовался на 12-20 тысяч лет раньше, чем то, что написали авторы, это как, все еще говорит о «быстрой колонизации»? Добавить 12-20 тысяч лет – это как, все еще «быстрая»? Или не стоит бросаться словами, без четкого определения, что есть что?
 
Предпоследняя фраза Абстракта говорит о том, что авторы нашли повсеместное бутылочное горлышко во всех гаплогруппах 10 тысяч лет назад. Ну, допустим. По нашим ранним данным с И.Л. Рожанским это было в ряде гаплогрупп примерно 6 тысяч лет назад, но отнюдь не у всех (например, у индейцев Северной Америки в гаплогруппе Q общий предок выявляется 16±3 тыс. лет назад, Klyosov, J. Genet. Geneal., 2009). Причин к тому могло быть много. Могли быть климатические условия, которые привели к сокращению популяций в разных концах мира, потому что 6 тысяч лет назад, как и 10 тысяч лет назад гаплогруппы уже разошлись по всему миру. Могло быть просто естественное вымирание относительно малочисленных древних популяций, просто статистическим образом – недостаток питания, мор, рождение девочек, что приводило к терминированию мужских линий. А как объясняют это попгенетики, авторы статьи?
 
«Мы выдвигаем гипотезу, что это бутылочное горлышко было вызвано культурными изменениями, которое влияло на разнообразие успешной репродукции среди мужчин». Это и есть последняя фраза Абстракта. Вообще сама фраза «репродукция среди мужчин» (among males) – сильная, «посильнее Фауста Гете», как сказал бы вождь. Только как авторы статьи это представляют? К тому времени носители гаплогрупп давно были уже в Европе, в Азии, в обеих Америках, в Австралии, в Полинезии, в Японии, и вот так сразу у всех независимо произошли «культурные изменения», которые повлияли на репродукцию, и загнали всех в бутылочное горлышко популяции? И почему именно «среди мужчин»? А женщины что, не в счет? Может, это женщины подкачали? Культурно развились, и решили, что, типа, а ну их всех, мужчин-то? Нет, с попгенетиками точно не соскучиться.
 
В обсуждаемой статье много забавного, много путаного, много того, что вызывает недоумение, насколько авторы не отдают отчета в том, что пишут ерунду. Например, они датировали время образования гаплогруппы R1a всего 5884 годами назад – кстати, обратите внимание на точность датировки. Попгенетики вообще необучаемы, поскольку к этой дате приводят погрешность между 4220 и 7743 лет назад. Представляете? Погрешность по их собственному признанию в две тысячи лет, а точность датировок, в том числе и погрешности – с точностью до года. Это уже какая-то ментальная патология. Да, так откуда датировка для R1a всего в 6 тысяч лет? А это – генетика, в понимании авторов. Вот откуда это получилось:
 

 
Как видим, авторы насчитали 152 снипа, отделяющих R1a от R1, в то время как R1b от R1 отделяет – согласно авторам – всего 17 снипов. Поскольку авторы определили гаплогруппу R1 на 23729 лет назад, и приняли, что снип образуется раз в… в общем, сейчас посмотрим, то для R1b у них получилось время возникновения 20912 лет назад, а для гаплогруппы R1a – 5884 лет назад. Вот теперь посмотрим, сколько у них оказалось лет в среднем на снип. Для гаплогруппы R1b – (23729 – 20912)/17 = 166 лет на снип, для гаплогруппы R1a – (23729 – 5884)/152 = 117 лет на снип. И вот такая несуразица у них в статье во всем. В статье 100 авторов, и никто не проверил расчеты.
 
И дело не только в расчетах. На картинке выше, и в таблицах в статье – вообще ерунда. Гаплогруппе R1a не 6 тысяч лет, а намного больше. Что, эти сто авторов вообще литературу не читают? Я еще в 2009 году определил возраст гаплогруппы R1a в 20 тысяч лет (J. Genetic Genealogy, 2009). Давайте для проверки посмотрим на данные группы YFull. От гаплогруппы R1 до R1a – 41 снип, возраст R1a – 22200 лет (доверительный интервал 24400-20000 лет), возраст R1b – такой же, 22200 лет (доверительный интервал 24400-20000 лет), возраст R1 – 27700 лет (доверительный интервал 30000-25500 лет). В среднем 134 года на снип. Возраст гаплогруппы R1a – 149 снипов, то есть те же 20 тысяч лет. 5884 лет у авторов – это вообще абсурд. Попросту говоря, верить авторам статьи нельзя ни в чем.
 
Можно, конечно, продолжать «разбор полетов» в статье, но зачем? Там несуразица на несуразице. Вот, пожалуйста, нашли у девятерых человек из Африки гаплогруппу В (это трое пигмеев Конго и Бака, двое сандаве, и четверо хадза) – названа, конечно, африканской по происхождению. Нашли бы R1b в Камеруне – тоже назвали бы гаплогруппу R1b «африканской по происхождению». Воистину, «что вижу, то и пою». Типично для попгенетики. Я уже сообщал выше, что сводная гаплогруппа ВТ, и ее производная В африканскими по происхождению являться не могут. Ясно, что переселились в Африку уже после образования гаплогруппы В. То же самое и с гаплогруппой Е, многие переселились в Африку уже позже образования гаплогруппы. Вот они и перечисляются авторами, как «африканские». Так африканские по происхождению или по современному месту жительства? Вот они – пигмей Конго, пигмей-бака, пигмей-баколо, пигмей-бедзан, трое сандаве, хадза, трое лухия, трое йоруба, двое масаев, и в придачу австралийский носитель гаплогруппы Е. Отчасти тот же состав, что и с гаплогруппой В. Если носители гаплогруппы Е туда, в Африку, переселились, так почему не могли переселиться носители гаплогруппы В? Молчат авторы статьи, не дают ответа, но тупо называют их «африканскими» гаплогруппами по происхождению. Популяционная генетика.
 
Авторы пишут о том, что они нашли, что в период 8-4 тысяч лет назад женщин было в 17 раз больше, чем мужчин. Судя по приведенным графикам, примерно 5000 лет назад мужское население Европы сократилось почти в 10 раз, а женское совсем не изменилось (по одному графику) или резко выросло (по другому графику), но в любом случае не уменьшилось.
 
Логично было предположить, что эти закономерности (если они в самом деле имели место) отражали истребление мужского населения прибывшим супостатом. Те, кто читают Переформат или мои книги и статьи в академических журналах, те знают, что действительно между 5000 и 4000 лет назад в Европе пропали почти все гаплогруппы (E1b, G2a, I1, I2, R1a), кроме R1b, которые в то время активно заселяли Европу. Ясно, что если мужчины пропали, а женщины остались и даже пошли в рост, как не пропали и эрбины (носители R1b), то это не может быть результатом каких-то уж очень катастрофических климатических изменений. Тем более подобный же сброс численности мужского населения при сохранении женской произошел, по данным авторов статьи, в Сибири примерно 900 лет назад и в Центральной Азии примерно в те же времена, удар по мужчинам с резким уменьшением их численности начался примерно 1000 лет назад. Ясно, кто там просматривается в качестве супостата. На Ближнем Востоке это произошло 7000 лет назад. И везде численность женщин не уменьшалась, или даже увеличивалась.
 
Но, как мы уже поняли, попгенетики статей и книг не читают, и сообразительностью, видимо, не обремены, поэтому о такой версии не знают и не догадались. Поэтому они не нашли ничего лучшего, как придумать, что это резкое падение численности мужчин отражает или «естественный отбор» («natural selection»), или вообще нечто заковыристое – «culturally driven sex-specific changes in variance in offspring number». По-русски это примерно «изменения в численности потомства, вызванные культурными изменениями, которые выразились в изменении специфических половых особенностей». Неплохо, не так ли? Прямо читается мечта либерала, что все вдруг стали «голубыми», и дети перестали рождаться. Причем в Европе это произошло 5000 лет назад, а в Сибири – 900 лет назад. Задержались в культурном развитии. В России, видимо, происходит сейчас. Ну очень хотелось бы, не так ли?
 
Нет, ну с попгенетиками, и с Балановскими среди этой сотни соавторов, действительно не соскучишься. Надо сказать, что и в этой статье расчеты времен жизни общих предков проводились с использованием печально известных «скоростей Животовского». Нет, попгенетики действительно необучаемы.
 
Анатолий А. Клёсов,
доктор химических наук, профессор
 
Перейти к авторской колонке
 

Поддержите проекты Академии ДНК-генеалогии: ваше пожертвование – это дальнейшее изучение истории наших предков, выпуск тематических книг, организация научных мероприятий, исследование палео-днк и ещё многое другое. У нас пока нет других помощников, кроме вас. Поэтому если вы считаете нашу работу полезной, нужной и можете её поддержать, то будем благодарны. Сделать пожертвование от 100 до 5000 руб. можно буквально в один клик по этой ссылке.

 

Понравилась статья? Поделитесь ссылкой с друзьями!

Опубликовать в Google Plus
Опубликовать в LiveJournal
Опубликовать в Мой Мир
Опубликовать в Одноклассники

Читайте другие статьи на Переформате:

26 комментариев: Могли ли мужчины «между собой» перестать давать потомство?

  • Валерий Юрковец говорит:

    «Глобальное изменение в культуре» 10 тысяч лет назад – это очень сильно. При чём здесь «изменения в культуре», когда причина лежит на поверхности – именно 10 тысяч лет назад закончился последний ледниковый период и наступила современная эпоха – голоцен. От льда и мерзлоты освободились огромные пространства зоны умеренного климата, и все гаплогруппы этой зоны и граничных к ней двинули в рост – классический пример «технического» бутылочного горлышка. Они что там – совсем безграмотные? Все 100 авторов? Ну, нельзя же так! Хоть бы на стратиграфическую схему какую глянули. Хотя бы для школьников.

  • И. Рожанский говорит:

    >> Гаплогруппе R1a не 6 тысяч лет, а намного больше.
     
    Но авторы статьи об этом не знают, потому что в выборке у них были только гаплотипы из ветвей, располагающихся под снипом Z645. Так что датировку они указали верно, для этой выборки она воспроизводится по перекрестным данным. О существовании ранее отошедших северо-западной (L664) и старой европейской (М198*) ветвей они, кажется, до сих пор не подозревают, а о реликтовых ветвях R1a1* и R1a*, охарактеризованных ранее их коллегами из Стэнфордского ун-та, решили не упоминать.
     
    И это при том, что в открытом доступе на проектах FTDNA можно найти сведения о сотнях носителей снипа L664 и о не менее 20-ти «старых европейцах» из Германии, Британии, Швейцарии, Италии, Словении, Хорватии и Македонии. В компании YFull есть данные о снипах американца голландского происхождения из старой европейской ветви и белоруса из реликтовой R1a1*, и по их расчетам, субклад R1a1-SRY10831.2 начал расходиться на ветви не позднее 12600 лет назад. Пока в YFull нет данных о снипах представителей реликтовых ветвей R1a*-M420, которые, несомненно, должны отодвинуть датировку еще глубже. Видимо, там еще не обработали результат ливанского араба, сделавшего тест BigY и идентифицированного как R1a*, или тот решил не отправлять свои данные для дальнейшего анализа. В любом случае, «возраст» гаплогруппы R1a не уступает R1b, которая в цитируемой работе была представлена гаплотипами из далеко разошедшихся ветвей R1b1a-P297 и R1b1c-V88.
     
    >> Это сейчас носители А00 живут в Камеруне, и на самом деле имеют общего предка примерно 400 лет назад.
     
    По имеющимся у меня данным, предок уходит примерно на 900 лет. Еще за 1,5 года до вызвавшей сенсацию находки гаплогруппы А00 эта ветвь была идентифицирована среди жителей города Фонтем в Камеруне, сдавших тесты в компании SMGF. Время жизни их предка было оценено как примерно 550 лет назад. По данным с проекта Ethnologue, там живут представители народности бамилеке, родственной и соседней с мбо. Результаты исследования этой группы камерунцев опубликованы в нашей с А.А. Клёсовым статье в июльском выпуске «Вестника Российской Академии ДНК-генеалогии» за 2011 год под заголовком «Архаичная (архантропная в терминах антропологии) линия гаплогруппы А. Это к вопросу о «лже-ученых», которые по странному стечению обстоятельств то и дело опережают «истинных ученых». Более того, попгенетики с открытием гаплогруппы А00 банально присвоили себе чужие заслуги, потому что вся работа была проделана в компании FTDNA по инициативе группы энтузиастов на частные пожертвования.
     
    Так вот, Томас Кран, которому в действительности принадлежит заслуга в расшифровке и интерпретации данных, анализировал не выборку из базы данных SMGF, что использовалась в нашей работе, а другую, с проекта National Geographic. По своему базовому гаплотипу эта группа отличается от группы соседей-бамилеке, а также афроамериканца Перри. При их сопоставлении и получаются те 900 лет до предка. Эта датировка попадает на время, когда предки мбо и бамилеке, жившие на плодородном плато в центре современной Нигерии, были вытеснены воинственными племенами скотоводов в менее благоприятные для земледелия горы Камеруна. До этого переселения там, очевидно, жили племена, занимавшиеся охотой и собирательством, о которых, насколько мне известно, не сохранилось никаких сведений. Видимо, все, что от них осталось – это чрезвычайно редкая линия, передавшаяся земледельцам Западной Африки, с доминирующей гаплогруппой E1b1a-М2. Кстати, мбо ни внешне, ни по языку, ни по обычаям ничем не отличаются от своих соседей, у которых доля E1b1a-М2 достигает 100%.

    • >> Гаплогруппе R1a не 6 тысяч лет, а намного больше.
      >> Но авторы статьи об этом не знают, потому что в выборке у них были только гаплотипы из ветвей, располагающихся под снипом Z645. Так что датировку они указали верно… О существовании… они, кажется, до сих пор не подозревают, а о реликтовых ветвях… решили не упоминать.
       
      Мы можем много рассуждать об их мотивах, о чем они не подозревают и что они решили не упоминать, и что у них было в выборке. Но приведенная в тексте выше маленькая картинка из их статьи, на которой они изобразили, что от гаплогруппы R1 к R1a ведет всего 17 мутаций по сравнению с 152 мутациями для R1b, красноречивее всех объяснений. И все сто авторов статьи несут за эту чепуху полную ответственность, потому что если они даже не запросили текст статьи, который шел в печать – это расписаться в своей роли просто пешек, с которыми никто не считается. Никакого чувства ответственности за содержание статьи, которую они подписывают – буквально или фигурально – у них не существует. Я потому и долблю попгенетиков и попгенетику – чтобы показать, во что вырождается «наука», у которой нет ни научной школы, ни достоинства авторов, ни чувства ответственности за свой продукт.
       
      >> Это сейчас носители А00 живут в Камеруне, и на самом деле имеют общего предка примерно 400 лет назад.
      >> По имеющимся у меня данным, предок уходит примерно на 900 лет.
       
      Я же специально указал – тех, кто живут в Камеруне (по которым есть данные). В статье Mendez FL, Krahn T, Schrack B et al: An African American paternal lineage adds an extremely ancient root to the human Y chromosome phylogenetic tree. Am J Hum Genet 2013; 92: 454-459 приведены 95-маркерные гаплотипы для 11 представителей племени Mbo. На все 1045 аллелей у них было всего 32 мутации. Общий предок их жил 32/11/0.182 = 16 условных поколений, или 400±80 лет назад. Если же добавить к ним афроамериканца Перри той же гаплогруппы (таким образом, выйдя за пределы популяции Mbo из Камеруна), то общих предок всех окажется «возрастом» примерно 900 лет. Наверное, можно еще кого-то найти, но вопрос не в том, и дан мной не в том контексте. А в том, что сама гаплогруппа А00 датируется примерно 200 тысяч лет назад, а общий предок ныне живущих носителей этой гаплогруппы жил совсем недавно. Поэтому эти понятия – древность гаплогруппы и древность общих предков наших современников из той гаплогруппы – нужно различать.

  • Валерий Юрковец говорит:

    >> «culturally driven sex-specific changes in variance in offspring number».
     
    Супер!!! Вместо действительно планетарного явления – окончания Валдайского оледенения и таяния ледниковых щитов нам подсовывают «sex-specific changes». Сексуальная революция в Ледниковой теории, климатологии и популяционной генетике! Эх, чому ж я не гуморист?! Надо позвать Задорнова – у него получится.

  • Kondrat говорит:

    >> Нет, попгенетики действительно необучаемы.
     
    Доктор биологических наук Савельев, занимающийся морфологией (структурой) мозга, делает вывод, что различия в коре головного мозга между людьми могут быть больше, чем видовые отличия между животными, например, между волком и лисой. Он также делает вывод, что эти различия (т.е. в том числе способности), по всей видимости, не передаются по наследству, т.е. генетически, а являются «социальными инстинктами». Человек рождается с «пустой» корой головного мозга.
     
    P.S. Что интересно, в «критиках» Савельева абсолютно те же люди, что и в «критиках» Клёсова А.А. Это лично меня поразило.

    • Сергей Кожухарь говорит:

      Ну что сказать, юродивых на Руси всегда хватало. Публикации Балановских — одна убогость и примитивность. Представленные А.А. Клёсовым аргументы в споре с популяционными генетиками очевидны для многих. Судя по видео с конференции по карачаевско-балкарскому народу, выступление Балановской превратилось в лекцию и (что еще хуже) набор поверхностных реплик. Малообразованность навязчивых Балановских бесспорна, как и то, что они не на своем месте. Что верно, то верно))

  • Виктория В.С. говорит:

    Анатолий Алексеевич, всякую ерунду в «арифметике» обсуждать нечего, можно только фиксировать. Нет никакой причины думать, что это может быть услышано теми, кто «употребляет» понятие погрешности так, как описано Вами здесь и ранее. Но один вопрос хочу уточнить. Здесь либо вкралась техническая ошибка при переписывании дат из статьи попгенетиков в Вашу (оптимистичный вариант), либо там именно это и написано, тогда совсем пессимистично для попгенетиков в количестве 100 шт.
     
    >> Например, они датировали время образования гаплогруппы R1a всего 5884 годами назад – кстати, обратите внимание на точность датировки. Попгенетики вообще необучаемы, поскольку к этой дате приводят погрешность между 4220 и 7743 лет назад. Представляете? Погрешность по их собственному признанию в две тысячи лет, а точность датировок, в том числе и погрешности – с точностью до года. Это уже какая-то ментальная патология.
     
    (7743+4220)/2= 5981,5, а не 5884…
     
    Понятно, что к сущности этих «результатов» это ничего не убавит, не прибавит. Уточнение нужно для исключения тиражирования искажённой информации, чтобы не давать повод «цепляться». Либо для очередной «фиксации».
     
    >> Авторы пишут о том, что они нашли, что в период 8-4 тысяч лет назад женщин было в 17 раз больше, чем мужчин. Судя по приведенным графикам, примерно 5000 лет назад мужское население Европы сократилось почти в 10 раз, а женское совсем не изменилось (по одному графику) или резко выросло (по другому графику), но в любом случае не уменьшилось.
     
    Логично было предположить, что эти закономерности (если они в самом деле имели место)… Здесь мне недостаточно, что «пишут авторы». Хотелось бы узнать «почему», т.е. какие показатели используются для утверждения, что «женское население не изменилось». Если это чисто попгенетические данные, то я ничего предположить, кроме знаменитого попгенетического «разнообразия», не могу. Видимо, таким образом интерпретируется то, что «женское разнообразие субкладов» не имеет ярко выраженных «потерь» субкладов, образованных в предшествующие периоды (хотя для этого есть ряд объективных постоянно действующих причин). Но на предположениях далеко не уедешь. Поэтому хотелось бы понять, каким образом из данных ДНК выполнена эта конкретная оценка количества населения (женского и мужского).

    • >> Но один вопрос хочу уточнить…
      >> Например, они датировали время образования гаплогруппы R1a…
       
      Уважаемая Виктория Викторовна, cнявши с попгенетиков голову, по их волосам не плачут. У них там в статье столько недоразумений, что сотня лет туда-сюда – это детская забава. На самом деле погрешность у них действительно не стыкуется со средней величиной, и, видимо, не обязательно должна стыковаться. Погрешность может быть несимметричной, и часто таковой является. Она симметрична тогда, когда усредняемые величины имеют равные «веса», и действительно являются истинным, статистическим разбросом. Поскольку попгенетики никогда до таких «высот» описания расчетов не поднимаются, и, как мы видим, у них и с арифметикой плохо, то чего уж там…
       
      >> Хотелось бы узнать «почему», т.е. какие показатели используются для утверждения, что «женское население не изменилось». Если это чисто попгенетические данные, то я ничего предположить, кроме знаменитого попгенетического «разнообразия», не могу.
       
      Я с самого начала статьи написал, что у них изложение вязкое и сумбурное. Поэтому расшифровывать их данные – мука. В отношении численности женского населения они используют параллельно несколько систем – и вроде как абсолютные величины (впрочем, не расшифровывая обозначения), и нормированные, относительные, но нормировать можно по разным частям кривой. Поэтому по «абсолютной» шкале у них женское население взмывает вверх по экспоненте, а по «нормированному» не изменяется, а мужское в то же время падает «стремительным домкратом». К тому же они насаживают по 12 рисунков на один, и проверить их все равно невозможно, да и не нужно, потому что данные там обычно третьестепенные по значимости, и вообще непонятно, зачем они их вообще приводят. В целом, все это образует некую невразумительную кашу. В общем, что в голове, то и на бумаге, в данном случае – в сети. Видимо, это про них А.С. Пушкин писал – «Тятя, тятя, наши сети…».

  • comrade-alex1 говорит:

    С интересом продолжаю читать ваши статьи. Спасибо. Хотел узнать, а насколько расчетная скорость мутаций – надежная вещь? Ведь по сути на ней построены все хронологические расчеты. И второй вопрос – может ли быть так, что мутации в ДНК в одном регионе планеты возникали с большей частотой, чем в другой (скажем, в местах, где радиоактивность была выше или по каким-то негативно-климатическим причинам и т.п.)?

    • Виктория В.С. говорит:

      Вопрос не мне, но я сделаю маленький комментарий, потому что уже сталкивалась с такой постановкой вопроса от людей мало знакомых с предметом наследственности. Это, кстати, свойственно многим людям. Потому что так много десятков лет в популярной литературе и СМИ используется этот термин. Ваше недоумение базируется на неверном однобоком понимании термина «мутация». Т.е. Вы мутации понимаете как «принудительное» изменение в ДНК под воздействием внешних обстоятельств. Разумеется, такие мутации тоже есть. И это не эволюция, а скачок, который может иметь скорее негативный результат. В данном случае речь идёт о мутации, как локальном изменении (среди десятков млн. химических соединений), которое произойдёт независимо от внешних факторов, вследствие свойств самого механизма передачи (копирования) фрагментов ДНК ребёнку от родителей. Молекула ДНК имеет эволюцию (изменение/развитие) даже в рамках одного биологического вида. Вот об этой «скорости» идёт речь.

      • Сергец говорит:

        Виктория В.С., а разве не имеются в виду изменения в генах, а не в нерекомбенантных участках ДНК, это не те мутации, которые вносят непоправимые изменения в организм, например, три ноги, четыре глаза?

        • Виктория В.С. говорит:

          Сергей, собственно слово «мутация» означает «изменение». Поэтому обнаружение «истории» изменений в участках, которые не являются генами, не меняют сути события – это тоже мутация (изменение) в ДНК. Для меня очевидно, что этот же механизм («сбой» при копировании) участвует и в изменчивости участков ДНК, где находятся гены. Я даже думаю, что это может быть основной причиной происхождения новых видов. Путём накапливания изменений у потомков, которые одновременно проходят «фильтрацию средой». Тот вариант, что Вы описываете про «три ноги, четыре глаза» – это одновременное множественное изменение (от внешнего воздействия) в яйцеклетках родителей, которые для формирования потомства предоставляют уже мутированную ДНК. Наверное, если результат будет жизнеспособным и передаваемый по наследству, это тоже вариант появления нового вида. Но «фильтр средой» действует и здесь. Поэтому-то чётное количество ног и два глаза выдержали испытание – законами тяготения, динамики и оптики, и других нет в природе.

    • Виктория Викторовна уже в целом ответила на вопрос. Я приведу некоторую аналогию – а насколько надежны расчетные скорости (на самом деле – константы скоростей) радиоактивного распада соответствующих веществ? Влияют ли на них регионы планеты, где проводятся измерения? Любой образованный человек ответит – конечно, нет, не влияют. Скорость распада радиоактивных материалов определяется исключительно «внутренними» свойствами вещества, а не внешними воздействиями. Это – фундаментальные показатели. Вот так же должен отвечать каждый образованный человек на соответствующий вопрос о константах скоростей мутаций в гаплотипах. Это – фундаментальные показатели. Никакие регионы, питание, физические упражнения, национальность, гражданство или партийность на них не влияют.
       
      Часто слово «мутации» люди понимают ограниченно, как поломка чего-то в живых организмах под влиянием внешних воздействий, обычно радиации. Но в гаплотипах – это не поломка. Это процесс филигранной перестройки, перемещения блоков нуклеотидов в ДНК. Например, в гаплотипах первое число у большинства (но не у всех) людей повторяется 13 раз. Это записывается как DYS393=13. Это означает, что в этом маркере четверка нуклеотидов AGAT, то есть аденин-гуанин-аденин-тимин, повторяется 13 раз. Вот так:
       
      GTGGTCTTCTACTTGTGTCAATAC/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ATGTATGTCTTTTCTATGAGACATACCTCATTTTTTGGACTTGAGTTC
       
      и эти повторы обрамляются уже неупорядоченными последовательностями нуклеотидов в ДНК, как показано выше. И вот «мутация» приводит к тому, что вместо 13 раз эта четверка стала повторяться у потомков 12 или 14 раз, в результате однократной ошибки копирующей ДНК-полимеразной системы. Ну как радиация это сможет сделать?
       
      Теперь вопрос – насколько надежны величины констант скоростей мутации в соответствующих маркерах Y-хромосомы. Они надежны настолько, насколько надежно их определяют, калибруют, проверяют исследователи. Когда это делают популяционные генетики – совершенно ненадежны, они это показали последними двадцатью годами их так называемых «исследований». Они до сих пор так и не знают, какие значения эти константы имеют. Я написал в конце статьи выше, что и в 2015 году, в обсуждаемой статье, опять используют «скорости Животовского». Причем «на полном серьезе» обсуждают, что на временах до 5 тысяч лет эти «скорости» сильно завышают датировки, и вот на временах 40-60 тысяч лет типа в самый раз. Они так и не поняли, что 23-маркерные гаплотипы на временах 40-60 тысяч лет вообще не применимы, там больше половины столь «быстрых констант скоростей», что они вообще не работают, потому что мечутся как белка в колесе. Это все равно, что секундомером измерять астрономические явления продолжительностью в тысячи и миллионы лет. И попгенетики этого так еще и не поняли!
       
      И Балановский при всей его безграмотности продолжает говорить о том, что в попгенетике все правильно, и что я «эксплуатирую» их небольшие погрешности, типа завышение датировок в три раза. И что измерения по снипам «высокоточны», намного точнее, чем наши измерения по мутациям в гаплотипах. Мы уже только что в очередной раз убедились в этой «высокоточности» в статье, в авторах которой оба Балановских, мать и дитя. С этой «высокоточностью» они намерили 17 мутаций там, где их полтораста. Каждый раз с этими Балановскими форменный цирк.
       
      Но выше шла речь в основном о мутациях в гаплотипах, с их филигранными перестройками, с вопроизводимыми константами скоростей. А вот в случае снипов картина может быть значительно более сложной и намного менее воспроизводимой. Там мутации не филигранны, там часто просто «поломки», простые превращения одного нуклеотида в другой, делеции (то есть просто выпадения нуклеотидов, иногда сразу нескольких) и прочие повреждения. Вот там внешняя среда может и влиять на мутации и частоту их появления, просто это пока мало изучено. Возможно, это поставит определенные и немалые ограничения для датировок по снип-мутациям. Иногда это видно даже простым глазом – например, выявляются десяток снип-мутаций там, где должны быть просто одна-две, чтобы было соответствие с уже выявленными закономерностями. Поэтому по снип-мутациям ошибки пока очень велики, возможно, такими и останутся.

  • Slava говорит:

    Ув. Анатолий Алексеевич, по большому счету данный вопрос требует физического рассмотрения с моделированием устойчивости процесса репликации к химическим и радиационным возмущениям. Аналогия с радиационным распадом здесь, по-видимому, не совсем работает, так как химические энергии связи всего порядка 1 эВ, того же уровня, что и от какого-нибудь вредного вещества или даже просто солнечного света. Будет время пересекусь с парой коллег на эту тему моделировавших биологию на суперкомпьютерах. Напишете совместные гранты, такие темы и на таких уровнях пройдут на ура. Есть необходимость или интерес?

    • Уважаемый Slava, Вы, видимо, как физик идете по пути физического моделирования процесса мутаций в гаплотипах, но этот путь вряд ли работает. Я понимаю, что каждый из нас использует свой язык, но дело здесь вовсе не в энергиях химической связи. Я строил аналогию с процессом радиоактивного распада не с точки зрения энергетики, а с точки зрения временных закономерностей. Как радиоактивный распад характеризуется конкретной величиной времени полураспада (полупревращения), которую ничем не сдвинуть в обычных условиях, так и мутации в гаплотипах характеризуются конкретной величиной времени полупревращения, которую тоже не сдвинуть в обычных условиях. Это происходит потому, что оба процесса происходят по законам кинетики первого порядка, которую диктуют «внутренние» закономерности объектов. Оба – стохастические процессы, в обоих «управляющая функция» является случайной величиной, хотя конкретные механизмы в обоих случаях совершенно различны.
       
      Ну, и что Вы будете «физически рассматривать с моделированием устойчивости процесса репликации»? Что, как Вам представляется, это даст? А я уже дам Вам ответ – константы скорости мутации в гаплотипах одни и те же для разных гаплогрупп и разных территорий, во всяком случае, никаких заметных отклонений не выявлено. Поэтому результаты Вашего моделирования уже предопределены. Зачем тогда им заниматься? Других, более значимых задач нет? Ну, получите, что константы скорости мутации начинают меняться при 100 рентген в час, а в чем полезность такой информации, кроме того, что испытуемые погибнут?
       
      Я бы с удовольствием изменил свою точку зрения, попробуйте меня убедить.
       
      Примечание: только не стоит переходить к дискуссии на тему, что рентген в час – это устаревшие единицы, и надо выражать в зивертах, но это далеко не все поймут.

      • Slava говорит:

        Ув. Анатолий Алексеевич, я ведь Ваше мнение не оспариваю, явно или скрытно, физики же всегда доброжелательны и в политику не играют, особенно, после такого яркого примера с Сахаровым, a ваши наработки уже наверняка вам говорят многое, что другие пока ставят под сомнение. Но вопрос этот пока формально открытый, кто-то должен независимо его подтвердить. Скажем, лазерные поля изменяют и некоторые типы ядерного распада, а курение и солнце вызывают рак, и убийственный рентген не нужен. Вы ведь специалист по химии рака, не является ли причиной рака кожи от излишков солнца значительное увеличение частоты мутаций, некоторые из которых достигают раковых форм? В науке и отрицательный результат – результат. А фундаментальные исследования Вашей академии пойдут только на пользу. Подтвердится независимость скорости реакций – ну и отлично, иначе этот вопрос будет постоянно возникать, даже здесь на историческом сайте уже не в первый раз.

        • Виктория В.С. говорит:

          >> Но вопрос этот пока формально открытый…
           
          Какой вопрос? Влияет ли внешнее воздействие на биологический организм? Ответ однозначный, влияет. Но, когда речь о биологическом организме, то это влияние либо разрушающее, либо изменяющее эволюцию в будущем. В биологическом организме нельзя на что-то временно «повоздействовать», а после «выключения» вернуться в исходное состояние.
           
          Для того, чтобы изменялась «скорость эволюционных мутаций» требуется воздействие на сам «механизм» формирования ДНК (который тоже биологический). Такое «точечное» воздействие, которое изменит только этот «показатель». Теоретически возможно, но практически маловероятно (в смысле невероятно). Более того, изменение механизма, которое его не разрушило в хлам, будет впредь передаваться у потомков. А поскольку таких потенциально (формально с точки зрения физики) подозрительных для воздействия на эволюцию биологических механизмов не счесть за время существования жизни на Земле, то это проявилось бы наглядно на ближайших к нам ветвях субкладов. Именно здесь больше всего и должны были проявиться «накопленные расхождения» – т.е. люди в этом случае должны были бы иметь разные механизмы формирования ДНК потомков.
           
          Опять же формально. В принципе, маловероятное тоже вероятно. Но 60-100-200 тыс. лет для того, чтобы это произошло, видимо, незначительный срок.

        • >> …я ведь Ваше мнение не оспариваю, явно или скрытно, физики же всегда доброжелательны и в политику не играют…
           
          Уважаемый Slava, про оспаривание, политику или доброжелательность в моем комментарии не было. Моя фраза «Я понимаю, что каждый из нас использует свой язык» – это даже не дискуссия, это констатация факта.
           
          >> Но вопрос этот пока формально открытый, кто-то должен независимо его подтвердить.
           
          Я вопроса вообще не вижу. В статье 2011 года в Advances in Anthropology мы с И.Л. Рожанским проработали несколько тысяч протяженных гаплотипов из разных гаплогрупп, и показали, что мутации во всех описываются одними и теми же константами скоростей. Этим вопрос был закрыт, и я не представляю, чтобы кто-то мог получить другой ответ, если эксперимент проведен корректно. Так что слова, что «вопрос пока формально открытый» – это или непонимание, или недоразумение. Что, впрочем, здесь одно и то же.
           
          Более того, не обижайтесь, но в цитате выше есть, на мой взгляд, еще одно принципиальное заблуждение, или непонимание сути науки. «Кто-то должен независимо его подтвердить» – никогда не решало никакой проблемы. Потому что часто это «независимое» оказывалось или ошибкой, или умышленной подтасовкой, или условия были другие и плохо совместимые с исходной задачей, или масса других причин. Скажем, попгенетики всегда пытались принизить значение (или поставить под сомнение) подход с использованием констант скоростей мутаций в гаплотипах. По сути, это было «раз у нас не получается, то и другим не дадим». Особенно этим славился Диенекес Понтикос, который как попгенетик (хотя называет себя «антропологом») вообще имеет смутное представление о константах скоростей мутаций. И вот выходит статья Busby с соавторами (2011), которые «показали», что если брать разные маркеры, то время общего предка каждый раз получается разным. Понтикос был в восторге, и объявил Y-STRs are effectively dead for age estimation, и провозгласил, что в своем блоге он вводит бойкот на расчеты времен жизни общих предков на основании мутаций в гаплотипах. С его точки зрения, работа Busby была той самой «независимой проверкой». На самом деле та работа была одной большой ошибкой, поскольку Busby использовал «скорости мутаций», полученных с 1700 парами отец-сын, то есть в одном поколении, где у трети изучаемых гаплотипов мутаций вообще не было (то есть константы скоростей мутаций были меньше, чем 1/1700 = 0.0006, а таких – десятки (среди 111 маркеров таких 39), а у многих было всего 1-2 мутации, то есть погрешность определения «скоростей мутаций» была примерно плюс-минус 100%. И таких примеров – масса.
           
          Никогда в науке «независимая проверка» не является аргументом, поскольку в науке, особенно на передних фронтах, никогда нет чего-либо завершенного. Нужен массив данных, множественные перекрестные проверки на протяжении длительного времени, причем проверки представителями разных научных школ, пока не появится что-то вроде «консенсуса», да и то почти никогда не незыблемого.
           
          Но Ваш вопрос поднимает интересную мировоззренческую проблему в науке. Это проблема приоритетов и целесообразности проведения исследований, то есть для чего это нужно, для решения какого конкретного вопроса, и насколько это нужно в смысле выделения на это денег и внимания. Вот Вы написали, что гранты на эту тему, то есть моделирования влияния радиации на константы скоростей мутаций в нерекомбинантных (то есть негенных участках Y-хромосомы), «пройдут на ура». Я в этом сильно сомневаюсь, поскольку не вижу в этом ни приоритетности, ни целесообразности. А аргумент «ведь этого еще никто не делал» является совершенно порочным в науке. Можно привести тысячи вариантов «исследований», которые никто не делал, и которые никому не нужны. Например, думаю, что никто не кормил воробья смесью из 17 видов зерен под лунным светом, и сравнивал бы с тем же в темноте. Думаю, никто специально не изучал влияние лунного света на рельсы, а там можно развернуть исследования о-го-го, меняя углеродный состав стали этих рельсов.
           
          Повторяю, что проблема уже решена нашими с И.Л. Рожанским исследованиями еще в 2011 году, и никто их не подвергал сомнению с данными в руках, которые (данные) можно признать корректными. «Моделирование процесса» никогда не бывает полностью адекватным, тем более что никто не знает детальный механизм, который лежит в основе ошибок копирующей биологической системы. В генетике не раз обсуждался механизм «проскальзывания» (slippage) при копировании, но в науке есть принцип, что то, чего нельзя проверить, не является научным. С таким же успехом можно сказать, что на то есть воля Господня.
           
          Если кто не понял, почему аргумент, что «этого никто в науке не делал» не является аргументом, приведу отрывок из моей книги «Интернет. Заметки научного сотрудника» (М., 2010, изд. Московского университета):
           
          На одном из научных симпозиумов много лет назад я прочитал доклад о целлюлазах, ферментах, превращающих целлюлозу в глюкозу. Целлюлоза — это длинные цепи молекул глюкозы, связанных друг с другом по типу «голова к хвосту». Эти цепи уложены в упорядоченные «пакеты», что в итоге приводит к образованию целлюлозных волокон. Поскольку структура целлюлозы упорядочена, целлюлоза состоит из кристаллов. Она настолько плотно упакована, что на нее действуют далеко не все концентрированные кислоты. Соляная кислота, например, не действует. Просто не проникает внутрь кристаллических «пакетов». А ферменты-целлюлазы целлюлозу разрушают. Так происходит круговорот целлюлозы в природе, иначе мы упавшими деревьями были бы завалены до неба. Эти ферменты я изучал.
           
          Так вот, рассказал я в своем докладе о целлюлазах, о том, что мы их получаем в очищенном виде и исследуем характер их действия, чтобы понять, как они атакуют целлюлозу, и попытаться применить эти принципы на практике, чтобы разработать биотехнологию целлюлозы. После завершения доклада подходит ко мне слушатель и спрашивает — а пробовали ли вы определить степень спиральности целлюлаз как белков? — Нет, говорю, не пробовали и не намереваемся, хотя знаем, как это можно делать. По дисперсии оптического вращения. Но желания нет. — Почему же, он спрашивает, ведь это, возможно, никто в мире не делал. — Не возможно, а точно никто не делал, говорю я. Я за литературой по целлюлазам внимательно слежу, и не пропустил бы. — Ну так сделайте, говорит он, — и будете первыми. Опубликуете статью.
           
          — Ну и что это нам даст? — спрашиваю. Ровным счетом ничего. Ну, например, найдем мы, что степень спиральности такой-то целлюлазы, скажем, 23 процента. Скажет это нам что-то о механизме действия целлюлаз? — Нет. Поможет это нам в разработке технологического процесса гидролиза целлюлозы? — Опять-таки нет. Видите, ни для фундаментальных вопросов, ни для прикладных эта информация ничего не даст. Вот если бы мы специально занимались спиральностью белков и ферментов, то эти данные, возможно, и были бы полезны для обобщений в данной области. А мы этим не занимаемся. Поэтому они для нас бесполезны.
           
          — Вы не понимаете, он говорит. Ведь это же в мире никто не делал! В смысле, не измерял степень спиральности целлюлаз. Неужели не интересно?
           
          — Нет, говорю ему. Так и разошлись, к его огорчению и непониманию.
           
          К чему это я? А к тому, что получаемые «научные данные» в огромном большинстве случаев не имеют отношения ни к фундаментальной, ни к прикладной области науки. Так, болтаются посередине. Потому что изучать можно что угодно. Например, толочь воду в ступе. Только это по научному назовут «Проблемы повышения дисперсности оксида двухатомного водорода механическим путем»…

           
          Но скажу, что если кто-то все-таки получит грант и при моделировании влияния радиационного излучения на константы скоростей мутаций в гаплотипах получит данные, важные либо для науки фундаментальной, либо для практических интерпретаций результатов тестирования гаплотипов Y-хромосомы, я хотел бы быть первым, кто авторов поздравит.

          • Slava говорит:

            Ок, ок, согласен, консенсус правильнее. Мы знаем – все определения никогда не полны, и наука всегда не завершена. А Ваш заклятый друг Валерий Лебедев наверняка здесь бы добавил и своего философского соуса на тот же винегрет по поводу критериев истинности эксперимента и теории. Плюрализм бы добавил и бесконечность конечного :-) Мое «согласие» – упрощение, часто вполне достаточное. Короче, если Вы в своей работе с И.Рожанским еще и показали, почему скорости мутаций одни и те же – то вопрос почти закрыт. Если нет – а он явно относится к фундаментальным как и многие вопросы «почему» – то кому-то может быть интересен. Повторю – этот вопрос – почему ничто не влияет на скорости мутаций – задают многие. Наука ваша молода и он на данный момент добавляет сомнений в ее применимости. С практической точки зрения он вполне может быть решен настройкой метода путем «сравнениями с экспериментом». Но для меня идеальным ответом было бы реалистичное моделирование процесса копирования ДНК на суперкомпьютере и доказательство степени его устойчивости к излучению и возмущениям моделирующим окружающую среду. Это я и имел в виду. Это не рельсы под соусом, так в будущем будут моделировать и создавать практически все, от новых форм жизни, где, скажем, нет места болезням и даже смерти, до уникальных материалов. На этом пока и закончим, не буду отнимать время, будет шанс, пересекусь с народом, моделирующем биологию, ДНК на самом глубоком атомном уровне. Возможно, что вопрос для них, как и для Вас, простой и принципиально давно решен.

            • Виктория В.С. говорит:

              Ув. Slava, у меня есть версия ответа на «почему». В части влияния разнообразной радиации, которая является постоянной составляющей жизни биологических существ. Правда, надо не забывать, что обсуждаемая «скорость» – это не скорость в физическом определении.
               
              1. Очень вероятно, что «сбои» в системе создания ДНК потомства есть как раз результат влияния внешних воздействий и полей.
               
              2. Если «сбои» провоцируются внешними причинами, то такие же точно отклонения происходят параллельно и в той части, где формируются гены.
               
              3. После превышения определённого порога мутаций в генах, в лучшем случае каким-то способом произойдёт прерывание развития возможного потомства, в худшем, рождается сильно «травмированный», который, однако, тоже не даёт потомства. Тем самым делается невозможным и дальнейшее распространение у потомков сильно мутированной нерекомбинантной зоны.
               
              4. В итоге, постоянство «скорости» для мутаций есть следствие того, что для биологического организма есть «порог» мутаций от внешних воздействий, который не убивает его жизнеспособности – вот у этого порога биожизнь и балансирует, всегда. Отсюда и фундаментальный характер постоянства констант.

  • Анатолий И. говорит:

    >> «culturally driven sex-specific changes in variance in offspring number»
     
    Здравствуйте, Анатолий Алексееевич! Хочется узнать, расшифровывают ли авторы статьи каким-либо образом эту фразу. В частности, что именно имеется ими в виду под «culturally driven…»? Какие именно культурные особенности населения Европы того времени, по их мнению, могли приводить к такому дисбалансу? Предлагают ли они в статье какие-то конкретные версии/предположения, к примеру, что-то вроде злостного кровавого матриархата и убиения младенцев мужского пола (вроде рассказов античных авторов об амазонках)? Или никаких расшифровок этого самого «culturally driven…», ни пояснений к тому, как они (авторы) к этому выводу пришли, в статье нет?

    • Нет, не расшифровывают. Нет этого в статье. Вообще попгенетики демонстрируют занятный феномен, только он не «culturally driven», а скорее наоборот. Я же не случайно почти каждую статью про попгенетиков и их опусы начинаю с того, что они сумбурные и вязкие. Казалось бы – нашли некий феномен, или им так кажется, что нашли – так дайте наглядное и понятное объяснение. Или честно напишите, что эффект налицо, а объяснить не можем. Но они так не могут. Ни честно сказать, что найти объяснение не могут, ни внятно объяснить. Вместо этого попгенетики начинают прятаться за невнятные фигуры речи, какие-то бессмысленные словесные конструкции. Напоминает старинную считалку-состязание, в которую играли дореволюционные барышни:
       
      Вам барыня прислала
      кусочек одеяла,
      велела не смеяться,
      да и нет не говорить,
      в черном-белом не ходить,
      вы поедете на бал?
       
      Вот попгенетики и стараются ничего конкретного не говорить и ничего не объяснять, чтобы не сказать что-то, что может быть хоть как-то определенно истолковано. Я проверил всю статью с приложениями. Слова culturally driven встречаются во всем этом только два раза, причем без малейших объяснений. Первый раз – это то, что процитировано выше в Вашем вопросе. А вот второй раз:
       
      Likely, the effect we observe is due to a combination of culturally driven increased male variance in offspring number within demes and an increased male-specific variance among demes, perhaps enhanced by increased sex-biased migration patterns and male-specific cultural inheritance of fitness.
       
      Я умышленно не буду переводить. Во-первых, не хочу насиловать свое чувство слова и фразы, которое у авторов напрочь отсутствует. Во-вторых, чтобы те, которые попытаются сами перевести и окунуться в эту словесную помойку, поняли, насколько процесс деградации попгенетиков зашел далеко. Это их «наука». И у этого безобразия – сто авторов!
       
      Так что тема «culturally driven» осталась нераскрытой. А ведь она вынесена в Абстракт!

  • Slava говорит:

    В науке о таких статьях хохмят – «братская могила». Но шутки в сторону. Для тех, кому все это только смешки – все будут докторами и академиками и вашими начальниками, между прочим, из-за высокого индекса цитирования.

    • Виктория В.С. говорит:

      К сожалению, это правда.

    • >> Для тех, кому все это только смешки – все будут докторами и академиками и вашими начальниками, между прочим, из-за высокого индекса цитирования.
       
      Возможно. Но не стоит столь линейно, доводя до абсурда. Среди авторов этой «братской могилы» наверняка есть толковые люди, достойные стать в будущем докторами и академиками, и которым будет стыдно (возможно, уже стыдно) за эту и подобные статьи. Но система, которую создали сейчас попгенетики, загоняет этих толковых людей в постыдную и позорную ситуацию, в которой они служат пешками, пушечным мясом. Я гарантирую, что они эту статью и не видели до ее появления в печати. Никто с ними не советовался, никто не спрашивал их мнения. Ими влекло единственное желание – получить еще одну статью с перспективой цитирований, которые можно вставить в свое «резюме». Уверен, что если среди них есть достойные люди (к Балановским это не относится), они вычеркнут эту статью, и подобные им, из списка своих публикаций и цитирования. Есть и такие, которые станут докторами и академиками, идя по тому же пути, как некоторые становятся губернаторами областей или генералами, которых презирают подчиненные. Тем стыдно, конечно, не будет. А будущее покажет, кто был на самом деле кем.

      • Валерий Юрковец говорит:

        Россия – страна традиционного консерватизма. У нас половые палеореволюционеры от популяционной генетики не имеют перспектив.

Подписывайтесь на Переформат:
 
Переформатные книжные новинки
   
Спасибо, Переформат!
  
Наши друзья